METABLE2 Genes

PROKKA_00018 SelectedGram+

GenomeSelectedGram+ ctg_1:21300-23435
ProductCDS Tetratricopeptide repeat protein
Inferenceab initio prediction:Prodigal:2.6,protein motif:Pfam:PF07719.11
Sequence
>PROKKA_00018 Tetratricopeptide repeat protein
ATGTTGACCCGTAACTGGCCCCGCCATCTGCTCTGCCTGAGCCTCAGCCTGCCGCTGGGT
TCGGCGCTGGCCTGCGGCCCGGACTTCCCGATGCGCCTGCTCGACAACCGCGCGCAGACT
TTGGCCGATTTGCCCGAAGGCAGCTTCAGCTTCGAAATCAGTCGCCTGGGTAAAACCATT
GCCGGGCTGAAAAACGTCACCGCAGCGACCCATAACCCCAACGACTATGCCGAAGACAAC
GCGTCAGAGCTGGCCCGCGAACAGGCTGAGCAGGTTGGCCTGAGCGCCGAGCAATACGCG
GTGGTCAAGCGCCTGCGTGGGCTCAGCGATGCCCATCAGGCCGAGGAGCAGGGCGCCAGT
CTGCCGGTGGAAATCCGTTTGTACGTTGCCGGCGCGGTGGCTTTTGCCACCGGTGATCAT
CAATTGGCCAGTGAGTATTTCAACAAGGTGCTGGCCCTGCCGGCAGACCAGCGTCCGTTG
CGCAGCACGTGGGCGGCGTATTCCCTCGGGCGCATCGCCTTCGCCATGAGCAACGGGGCG
CACAACCGCATCGAAGCGCTGGAGCAGGCGCGCGATGCCTTTCGCCAGGCCCGGCAACTG
AGCATCGACGGCTTCAGCGATCCGCTGGAACTGGGCGTTGCCAGCCTCGGTGAAGAGGCG
CGGGTGCTGCGCAGTGCTGGCGACTGGAGCGGCGCCATCGAACTGTACGAAGCACAGAAC
CTGCACGGTTCGGCCGTCGGTTACACCTCGCTCAAGCAACTGATGAACGAACTGGCCGAA
TTGCCGGAATCTCAGCTGGCCAAACTGCTGCAGCTGCCAGCAGTGCAGCAACTGGTCACG
GCGTCGCTGGTCAGCCGTCAGGGCTGGTCTTTCGGTGAGCAGCCGCCGAATGAAAAGAAA
CTCGTCACACTCCTGCAAAACAGCACCCGTGGCAGCCTCGACAATGCCGATCGACTGGCG
GCGATGAGCTATCAACAGGGTGACTACGCGTCTGCCAAGGCCTTTCTGGTAACCGCCGGG
GACGGCGGGCTGGCCTGGTGGCTGCGGGCAAAACTGGCAGTGCGTGACGGCGACACGACT
GCCGCTGCCGCCGCCTACGCCAAAGCCGCCCAGGCCTTTCCGCAGAACGAAGACTGGGGT
TATCGCCGCACACCGGACTGGGCGTTTGAAACGGTACAGCCAAAATGTCGGGTGGAGGGC
GAAAGCGCGATCCTGGCGCTGCAACGCGGCGAATACCTGCAAGCATTCGTGCAGCTGTAT
CGCAGCAACAGCCTTTACTGGTTCGATGCCGCCACCGTTGCCGAGCGGGTGCTGACGGTC
GATGAGCTCAAGCGGTACGTCGATGAGAACGTGCCGGCGCCGCCGCCATTGACGCAGCAA
GAGCGCGACAACTATGTGCCGCTGTCGGTGGCCGCCAACCTGCGCAATCTGCTCGGTCGG
CGCTTGCTGCGTGAGGGCCGTTACGAGGAAGCGGCCGGTTATTTCGCCAGTGACGATCTG
CAGCACAAGGCCCGGCTCTATGGCGAGCAACGGCTCAAGGCCGAGTCGGCGTGGTGGCCG
AGCAAACGCGCCAGTGCGTTGTACAACGCCGCATGGACAGCCCGGGAGTGGGGCATGGAC
ATCCTCGGTTATGAGATGGCGCCTGATTACGCCACCTTCGGCGGCAATTACACACTGGAA
AGCACGAAGCTGGATGTCGGCCCGCTGATTTCCACGGCGGAAGTGCAGCGCCAGCAGGCC
AGCGCCGCGCAACCGGATCAGCGTTATCACTATCGTTTCGTCGCCACGGCACTGGCCAGT
CGCGCCGCCGATAACCTGCCGCACACCAGTCAGGCGTTTGCCGCCGTGTTGTGCAACGCG
GCCGGCTGGAACAGCAGCCTTGAGGACCAGAGCGCGCTGTATCAGCGCTACGTCAAGGAA
GGCCCTTATGTGCCGTGGGCGCAAGACTTCGGCAATCAATGCCCGTATCCGGACTTCGAA
AATGCCGACAAGCGCTACGTCACCCAGGTGACCGATGCCGTGCGTGAAACGCTGCGGCCG
TACAAGTGGCCGGTGCAGATCGGCGCGATCGTCGTAGTCGCGGCCATCGCGTTACTGCTG
ATCACCCGTCGTCAGCGCAAGGTCCGCAAAGGCTAG