METABLE2 Genes

PROKKA_00022 SelectedGram+

GenomeSelectedGram+ ctg_1:26385-28346
ProductCDS SPFH domain / Band 7 family protein
Inferenceab initio prediction:Prodigal:2.6,protein motif:Pfam:PF01145.19
Sequence
>PROKKA_00022 SPFH domain / Band 7 family protein
ATGCAAGTCGATCTTGAGTTGGACGCCAAGTCAGTCACCGGGCTGCCGCGCTTTCAGCAA
GCAGATGCGCAGTCACGCAAATTACGTCGGCTGGCTTATGGACTCGGCGCATTGGCCGCG
TCGGGCTGGGTGCTGGCGTTTTTCGTCGGCCTGTTTGCGCCGCAGTCCCTGTGGTTACCG
TTATTGGTCAATCAGAGCGCGGCTTTGCTGGTGCTCGTCGCCGGTCTGCAATCGGCCGGG
TGGGTGACGCAATGGCGCGCGCGGGTGATGCATCCGCCCGCCTCGCAATCGACCGTCGAG
GAAGAGGGCGGCGCAGCCGAGGGCTGGTACGAAAGGCTGCTGGAGCGCTTGAGTCAGCAG
AGCCGCCATCTGCTTGGACAAATCGGTGCGCCGACGTTGTGGCTCGGCGGTTGGGCGTTG
CTGGTTCTGCTTGGTATTGAGCAGGTGTGGAATCTAACGTTGCCTGCGGCGGCCTTGGGG
CTGTCGGCGAGCATCGGTGCGGCGTTGGCGTTGTTGCTGGCGTTTGTCCTGCTGGTGCTG
GAGCGGCAACTGGCGCAGGAACCGCCGGCGCAGTGGCCGGAAGCGGCTGCGCTGGCACAA
CTGATCCGGGTGGTGATCATCACTCTGTTGATCGGTGCGCTGTGTCTGTTGTTTGCCAGC
GAAGACGCAGTCTGGCCGGCGCGTGTTGCGGTATTCAGCGCAATCCTGCCGATGTTGGTT
GCCATCGAACTGTTATTGCGCGCGGTGCTGTCTGTTTTCAGCCCGCGCCGCGAACAACTC
GAACCGACCCTGCTGGCGCGCAGTTTTATCGCCGATATGCTGCGTTGGCCGCCGCAGCCG
TGGCTGGCGTTACAGCATGAAATGCACAACCGTTTCGGCATCGATTTGCGCCAGATCTGG
GCCTTCAGTTACATGCGCCGGGCCTTGTTGCCAGTGTTGGCGGTGGTCGCCCTTAGCGGT
TGGCTGCTGACCGGCGTACATGAAATTCCCCTGCAAGGTCGCGGCATCTATGAGCGCTTC
GGTAAACCGGTACAGGTTTTCGGCCCGGGTTTGCATAGCGGGTTGCCTTGGCCATTGGGG
CGTGTGATCTCCGTTGAAAACGGCGTGGTCCATGAACTGGCAACCAGTGTCGGCGACAAG
CCAATCACCGTGCAGTCCGACTCCGCTGAAGGCCCGGCGCCGGTGACCGCCAACCGTTTG
TGGGACGCCAGCCACGTCAATGACAAATCCCAGGTCATCGCCAGCAGCCGCGGCGCGCAA
CAGGGCCTGCAAATCGTCAACATGGACGTGCGCTTCGTTTATCGCATCGGTTTGAACGAC
GAGGCGGCGCTCGCCGCGACTTATAACAGCGCCGATGTACCGACGCTGATTCGCAGCACT
GCCAGCCGGATCCTTGTTCACGATTTTGCTTCGCGCACCCTCGACGGTCTGCTTGGCGAC
GACAGGGCAGGGCTGGCCGAGGAAATCGGTCGCTCGGTGCAAAGCGATCTGAACAGATTG
AACAGTGGTGTGGAGATCCTTGCCACAGTCGTCGAAGCGATTCATCCACCGGCCGGCGCG
GCGAATGCCTATCACAGTGTGCAAGCGGCGCAGATCGGCGCGCAGGCGTTGATCGCTCGC
GAACGCGGGGCGGCTGCGCAGGCCACTAACGAGGCGCAGTTGCAGGCGAGCGCGGCGCGG
GATCAGGCAACGGCAAACGCGCGGGAGATCAGTGCCGCTGCGCAAACGGCAGACCTGAAA
TTCAGCGCCGAGCAGAAAGCCTTCGCCAGTGCTGGCCAGGCGTTTGTACTGGAGCAATAT
CTCAGCCAGCTCAGTCAGGGCTTGAGTAAAGCCAGGCTGCTGGTGCTCGACCATCGACTT
GGCGGGAGCGCAAATGCGCCAACCATCGATCTGCGTACTTTCACACTGCCGACTGATCCG
TCGTCCCCCCGCACCACCGCTCAACCAGGAGCCACCCATTGA