METABLE2 Genes

PROKKA_00028 SelectedGram+

GenomeSelectedGram+ ctg_1:35271-35789
ProductCDS hypothetical protein
Inferenceab initio prediction:Prodigal:2.6
Sequence
>PROKKA_00028 hypothetical protein
ATGAACGTTCGTCTGCTGGGTTTGGCGCTGGGCCTGGGTTTGGCATTACCGGTGGTTGCG
CAGGCACAAATGCTGCAGCCGGGATTGTGGGAAATGTCTTCGAGCAATCTGAAGGTCGAT
GATCAGGCCATGGACGTGCAATCGATCCTTGGCCAGATTCAAGGCCAGATCACCCCGCAG
CAGCGCGCGGCGCTGGAGAAGAACGGCATCAACATCGGCGGGAAAGGTATCCGCGCCTGC
CTGACGCCGCAGCAGGTCGCGACCAACGACATCCCGCTGGCCGATCCGCAATCGGGCTGC
AAACAGCAGATCACCGAGCGCACCGGCAACCAGTGGAAATTCCGCTTCAGCTGCCCGAAA
GCCCAAGGTACCGGCGTGGCGACATTCCTCAGTGACCGCGAATTCACCACCGTTGCCAAT
GGCACCTTCAACGCCATCGGCATTAACCAGAAGGGCAGCCTGGAAACCCGGGCAGTGTGG
CTCGGCCAGGATTGCGGTACGGTAAAACCCCGCGCTTAA