METABLE2 Genes

PROKKA_00029 SelectedGram+

GenomeSelectedGram+ ctg_1:35871-36746
ProductCDS putative periplasmic iron-binding protein precursor
Inferenceab initio prediction:Prodigal:2.6,similar to AA sequence:UniProtKB:Q57449
Sequence
>PROKKA_00029 putative periplasmic iron-binding protein precursor
ATGCGCGCTCTATTCGTGCTGTTCAGCCTGATGCTGTCGATGTCATTGTCGGCCGCCGAA
AAACTACCGGTCGTCACCAGCTTCAGCATCCTTGCCGACATGGTTCATCAGGTCGGCGGC
GAACACGTTGAGATCACCAACATGGTCGGCGCAGATGCCGATGCGCACACCTACGAGCCA
AACCCGGACGATGCCAAGGCATTGCTCAAAGCCAAAGTGATCATCAAGAACGGCCTCGGT
TTCGAGCCTTGGCTGGATCGCCTGGTGACCAGCACCGACAGCAAGGCGACGGTGATCAGT
GCCAGTCGCGGGGTGATTCCACGTTCGCTCGATGAAGACGGCGAGACTGTTGCGGATCCA
CACGCCTGGCACAATCTGGCGAACGCTGAGTCGTACGTCGCCAACATCACCAAGGCGCTG
ATCGCCGCCGACCCGGCCAACAAGGCTGACTACGAGCGCAACAGCCAGACCTACCTCAAG
CAGATCTATGCCCTGCTCGCCGAAGCCAAAAACAAACTCGGCGCGCTGCCGCCGGGTAAT
CGCAAGATCGTCACCAGCCACGATGCCTTTGGCTATCTGGGTCAGGCCTATGGCATCGAC
TTTATCGCGCCACAGGGTTTGTCCACCGAACGCGAACCCTCCGCCGCCGAAGTCGCTGCG
CTGATCACGCAGATTCGCCAGGCGAAGGTCAAAGCGGTGTTCATGGAGAACATCAAGGAC
GCGCGTCTACTAAAGCAAATCGCGGATGAAAGCGGCGCACACATCGGTGGCACGCTGTAC
TCGGATGCACTGGCGGCGAGTGGACCGGCGAGCACCTTTACCGGGCTGTTCGAATACAAC
CTCAATACGCTGTACAAGGCGTTGAGTCAGCCATGA