METABLE2 Genes

PROKKA_00033 SelectedGram+

GenomeSelectedGram+ ctg_1:39272-39649
ProductCDS hypothetical protein
Inferenceab initio prediction:Prodigal:2.6
Sequence
>PROKKA_00033 hypothetical protein
ATGAACAATGGGTTGAAATACCTGCTTTTGAGCTTTGCTACGTCGCTGGCCGGCCAAGCC
CAAGCGCAGATGCCCTCGCTTGCGCACTGCACGCGCAGCGCTAATTTGCTGGCATGTGTG
GACGCCGACGGCAATGCCTATAGCGTCAATACGGTCGGCACCACGCTTTACCTGCGCGGA
TTCGAGAAGGACGGCCATCGCTATTGGGCGCAAACCAACAGCCGCTTCGGCCAGTTAACC
TTTTTTACCGGCATCGCCTCGGATGGCGAGGCTTGGGTTGGCTATACCCGTCGTGTCGGC
TGGACGACCATCAACCGTTTTTCCAGCTCGGGTGGTAGCAGCGCAAGGTTCACTTGCAGC
CGGATGACGGGCTGCTAG