METABLE2 Genes

PROKKA_00035 SelectedGram+

GenomeSelectedGram+ ctg_1:41064-41714
ProductCDS hypothetical protein
Inferenceab initio prediction:Prodigal:2.6
Sequence
>PROKKA_00035 hypothetical protein
ATGCTCGTACTCAAGGATCGGCCGCTTCTTGCCCGTCATCAGTACCAGGGCCTGAGCCCG
CAAACGTTGACGCGAATCCTGGAAGACCAGACCAATCTCGCCGTCTGGCAACGCCAGCTA
CCCGTGCACATCGCCGATTTTGCGCAATTGGTGCTGTCGCTCAACGAGCCCTTGGCCGAG
TCGCTTTGCCTGGAATTGGCTGACGAGGACGCTGAGCCGGATCTCGCCGGTCTGGCTGCA
GGTCTGCGTGATCTGCACGGTTTCGAAGGTTTCATCAGCGACCTCAAATGGCTGATCAGT
GCCTTCGCCTGCCTGCTGGGCGCGCGGCGTATCGGCGTGCGTTTGCGCGTGCTGGACAAG
GCCATGTGTCCGCGTTTCCACGTCGATCACGTCCCGGTGCGCCTGATCACTACTTACGCT
GGCATCGGCAGCCAATGGCTTGAGGAGGGTGCGATGGACCGCGCGCAACTTGGCCAGTCC
GATGCCGAACCGCAAGATCCAGCGTCGATTCGCCAGCTCAACAGCGGCGACGTCGCGCTG
CTCAAAGGCGAAAAGTGGCACGGCAATGAAGGCTTCGGCCTGATCCATCGTTCGCCGCAA
CCGGCACCCGGTGAGCGCCGTCTGTTGCTGACCCTCGACTGGCTCGGCTGA