METABLE2 Genes

PROKKA_00036 SelectedGram+

GenomeSelectedGram+ ctg_1:41719-42075
ProductCDS hypothetical protein
Inferenceab initio prediction:Prodigal:2.6
Sequence
>PROKKA_00036 hypothetical protein
ATGCGCTGGTCGGGATGGTCGTTGCTGTTGGCGCTGCTGTCGAGTGAAGCGTGGGCCCAG
GCCTGCGTGGTGCACACACAGGGCGAACGGCTCGACGTCAAAGTCTGTCAGCAGAACCGG
ACGATTCCGCAGAAATTGTTCAATGACGGCTTCTGCCAACCGACGCTGGCCGGGCAGAAG
GTCGAGGTGCAATACGTCGACCAGTGCCCGAGCGGCGCTTTCGGCGTGTGCAGCAACGCG
CAAGTCGCCAATATGCCCTATCGCCAGGATATCCACTATTACGGCGTGGCCACCGATACG
GCGTATCTCAAGCCATATTGCGAAGGCCAGAGCCAGGGCGTCTGGCGCAAGCCCTGA