METABLE2 Genes

PROKKA_00038 SelectedGram+

GenomeSelectedGram+ ctg_1:43089-43502
ProductCDS hypothetical protein
Inferenceab initio prediction:Prodigal:2.6
Sequence
>PROKKA_00038 hypothetical protein
ATGCTGACCCTGGAAAACATCTTCGTGCTGATGCTGTTCGCCGCCGCTGGTGCCTGGCTA
TGGCACAACCACGGCTTGCGCGAGCGCGCGCTGGAGCGGGTCAAACAGCATTGCACCAAT
GTCGGCGTCGAGCTGCTGGACGGTAACGTCGCGCTGAAAAAGATCGGGCTGATCAGGGAT
GCCAACGGTCGCCGACGACTGGCGCGGGTCTACAACTTCGAGTTCACCGTGACTGGCGAA
AGCCGCCACAACGGCACCGTCACCCAGTTCGGCGCGCACAGTGCGCAGATTGAACTGGCA
CCCTACCCGGCGCCGTTCGACGACACGCCGCCGGTGGTCGAAGTCCACAAGCCTCGCGCA
GAAGTCATCGAGCTGAGCCAGTGGCGCCAGGAACATACCAAGTGGAAACCTTGA