METABLE2 Genes

PROKKA_00042 SelectedGram+

GenomeSelectedGram+ ctg_1:47144-47551
ProductCDS hypothetical protein
Inferenceab initio prediction:Prodigal:2.6
Sequence
>PROKKA_00042 hypothetical protein
GTGGAAGAAATCATCGAACAACTGCGCGAAGCCAACGAACCCGTACCGGTTCCTTTGGAA
TTGCCTGACGAAGACCTGCTGGTGGAAATCGAAGAACAACTGTTCATCGACATTCCGTTC
GTCTTCAAAGAATTTTTGCTCACCGTCAGCGATGTGGTCTATGGCAGCCTCGAGCCGGTG
ACCGTCACTGACCCGCAATCGCACACCTATCTGCCGGACGTGGCGGCCAATGCATGGGAC
GTGGGTGTTGATCGCAGCTTGATCCCGATCTGTCAGGACGGCGATGACTACTACTGTGTC
GAAGAAGACGGCACCGTGGTGCTGTGGCAGGCCGAAGAAGAACTGATTGCTGAAGAAACC
TGGGAATCGGTGTGGCACTGGGCGCGGGACGTCTGGCTGGAAAGCTGA