METABLE2 Genes

PROKKA_00043 SelectedGram+

GenomeSelectedGram+ ctg_1:47687-48562
ProductCDS Tim44-like domain protein
Inferenceab initio prediction:Prodigal:2.6,protein motif:Pfam:PF04280.9
Sequence
>PROKKA_00043 Tim44-like domain protein
ATGAAACGTTTTCTTAGCATCGCCATGGCGTTGTGCATCGGCCTGACGATGAGCCTCGAC
GCCAACGCCAAGCGCTTTGGTGGTGGCAAAAGCGCCGGCGCTGCGCCGACGCACCAGACC
AGCCAGATGGCTCCTTCTTCTCCAGGCGTGGGCGGCGCAGCAGCGACCGCTGGCGCTGCC
GGTGCTGCTGGCGCCGCGGCCAAGGCCGGCGGTGCGTCGCGCTGGCTCGGCCCATTGGCG
GGCATCGCCGCCGGTGGCCTGCTCGCGTCGATGTTCATGGGCGACGGCTTCCAGGGCATG
CAGATCTTCGACATCCTGATCATGGCCCTGATCGCGTTCGTGATCTTCCGCTTCATCGCC
GCCCGTCGTCGCAAGCAGCAGGAGCAATTCGCTCCGGCCGGCGCGCCGATGCAGCGTGAA
GTGTTCGAGCAGAAGCCTGCCGCCATGGGTTCGATCTTTGGTGGTTCGGCTGCTCCGGCT
GCCGCCCGTCCGGTGATCAACGCACCGGCCTGGTTCAACGAAGAGCGCTTCCTTGAAGCC
GCGCGCAGCCACTTCCAGTCGCTGCAGCAGCACTGGGATGCCAACGAAATGGACAAGATC
GCCGAGTTCGTGACCCCGCAAATGCTTGAGTTCCTCAAGCGTGAGCGTGCGGATCTGGGC
GATGGCTTCCAGTCGACCTACATCGACAACCTGCAGGTGCAGCTGGACGGCGTCGACGAT
CGTGCCGACAAGACCATCGCCACCCTGACCTTCACCGGCGTGTCGAAAACCTCGCGTTTC
GACCAGGGCGAAGTCTTCAGCGAAAGCTGGAACATGGAACGTCCGCAGGGCGACAACCAG
CCTTGGCTGGTCGCCGGTATCCGCCAGAACGGCTGA