METABLE2 Genes

PROKKA_00047 SelectedGram+

GenomeSelectedGram+ ctg_1:55404-55607
ProductCDS hypothetical protein
Inferenceab initio prediction:Prodigal:2.6
Sequence
>PROKKA_00047 hypothetical protein
ATGGCTCAGCCCTACGAAGAACGCAACAGCGCCGCGAAAACCCGTCGTCAGCAGGAAGAT
CAGCGCCGCATGGAATTTCGCCGCGCAATCGAGGATCGCTTCGAACTTCGCCAGCTTCAG
GCCGAGATCGGCGATTTTCCCGAGATCACGCATTGGCAGGCAACGCCCGCAGCTTCCCGT
CGAAACGCTCAACCAACGCAATAA