METABLE2 Genes

PROKKA_00051 SelectedGram+

GenomeSelectedGram+ ctg_1:60239-62401
ProductCDS Extracellular serine protease precursor
Inferenceab initio prediction:Prodigal:2.6,similar to AA sequence:UniProtKB:P09489
Sequence
>PROKKA_00051 Extracellular serine protease precursor
ATGGGTTGCGTAGCGCTGGCGAACGCCGAGCAATCCACTGAAGCAATCGAGCAGCCCCCA
AGCATGGAAACGACGGAGCAGCCCGAAGCCAACCCCAAGCAACAGGCTTTGGAACGGCTC
CAGGGTTTTCTCAACGACGCGAGCACAGTGCCGATTACCTTTACGACACCGGAAGCCGTG
TTCAAAGGGACTGAAGTCAACGACTTGATCACCCTTGCAGACGGGGCAAGCTTCACTGGC
CGGCTGGATGGCGGCAAGGGCGATAACGTGTTGTTCCTGAATGCTGCGGATGGCGGCACG
TTGAACGACACGCGCAACTTCAATGGGTTATTCGTCGCCCAAGGCGACTGGACATTGAGC
TCCAAAGGCGATTTCCATGAAGGTGTTCTGGTCGACAGCGGTGGAGCGTTGACCAACCTC
GGCAGCATCAAGGGTGATGTGTATGTCCAGAATGGCGGCAGTTTCGCCGGTAAAGGCACG
GTGGGAAATCTTGAGGTGGGTGGGCTGCTCACCGTCAATGCAGCGCTTGGCGCACCACGA
GTGAAGGGTAATTTGCACTTGGCGCCTGGCGCCGAATTGGCTTACGAGGTCACTCCCGCT
GGTGGTCAGACGATCAAGGTCGATGGCACAGCTCAGCTTGACGGCGCCACCCTGAAAGTC
GTCGCGGCGGGTGAATATCCGCAGAGCAGCCAATACAAAATCATCGAAGCCCGTGAGGTG
AAAGGCGAGTTTGGCCGGATCGAGAACGATCTGGCGTATATGACGGCCACGGCTCAATAC
AACAAGAAATCGGTTGGGCTGACTTACGCTCGCAATGATGTAGCACTTGAAAGCCTCGCG
CCTACGGAAAACGCAGCTGCACTTGCAGGCAGTATTACCGGGCAGGAAGCATTAATTGCT
ACAACTGCACCGACCTCAACACCCACTTCGCCAATGCCCGCTTCAACTCCTACGGCAGCG
GTCATCGCAGTGCCAGTTCCAGTTCCAGTGCCAGTCCTGACCTCGGTTGCAGCCCTGATT
GAAGACTCCGCGCCAGCGATTTCATCAATACCAAACGAAATCTTGACTGCGCAAACCAGC
GAAGCCGCCGCCCAGCCCGTGCCTCAACTTACAAAACCTGCTAACGCTGCAGTAGCCGCA
CTGCTGACCAGCGATAAAACCACCGCGCCCATCGCCCTCGATCAACTTGCCGCAGGCAGC
AATGCCAATCTCGCCAAAGCCACGCTGAGCAGTGTCACACCTGTCAGTGCGAGCATGCTT
TCGGCGATGCGGCAGCTGGACAATCATTCCGCCTCGACCTACGGCTCGCGCAGTTCACCT
CGTCAGGCCGCAGGCAGCGAAGGCTCCGGGCGGGTGTGGGTTCAGGCGCTGGGCCACGGC
GGCAAGGTTGACCGCGACGCTGACGGCATCCTCCAACATGCCACGCAAGGGCTGGTCGTG
GGCGCTGACTGGCGACTCGATGAGCACTGGCATGTCGGCCTGCTTGGCGGCAAATCGCAG
ACGAAACTCGATGCCCGCCAGTACGATGGCGACCTCGACAGCTGGCATCTCGGCGCCTAT
GCCGTGCGTCAGGACGGCCCGCTGTCGCTGCGTCTCGGCGCGACTTACGCCAGCCATGAC
GGCAGCAGCACACGGCGGGTCGCGTTCAAGGGTTTCAGCGATCGTCTCAAGGGCAATTAC
GACGCCAATACTCAGCAAGCATTTGCCGAGGCCGGGTTCAACCTGGGCCGCAACAACGTG
ACCCTCGAGCCCTACGCCAACCTCGGCTATCAGCGCTATCAGCGCGACAGCTACAACGAA
AAGGGCGGCGACGCGGCGTTGAAAGTCTACGGCCAGACCCGCGACAACTTCAGCAGCACC
TTCGGTCTGCGGGTTGCGCAGGTCAATACGCTGGATAACGGCATGCATTTGACCCCGCGA
TTGAGCGCAGGCTGGAAACATAACTACGGTGACATCGACAGTGACACCCGCCAGCAACTG
CGCAAGGGCGGCAAGCGCTTTGAAGTGACCGGGGCGGCACTGGATCGGAACAGCCTCGCG
GTGGATGCGGGGCTCGATCTTGGCCTTTCGGCGGCGCACACACTGGGCGTGGGCTTAACG
GGTGAGCTGGGTAATGACAGCCGATCGTATGGCGTGGCGGGTCAATGGCGCATGGCGTTC
TGA