METABLE2 Genes

PROKKA_00052 SelectedGram+

GenomeSelectedGram+ ctg_1:62828-64177
ProductCDS putative DNA-binding transcriptional regulator
Inferenceab initio prediction:Prodigal:2.6,protein motif:CLUSTERS:PRK09775
Sequence
>PROKKA_00052 putative DNA-binding transcriptional regulator
ATGTATAAGCTGACACTCCAGATCTTCACCGCCGGGCAATGGCACGACGCGATGATTCTT
GACTTCGATGATCCGGAAAAAGGCTTCGAAAGCCGCTGCAGTTTTGGCTATGAAGCGGAC
TATCTGGTGGAAAACATCGAGTTGATCGGTTCGCCTTTTTCCCAAGCCGTGAGTGCCCTG
TATCCACTGGATTGGGAAGGTCGGCGCGCGAAGACGCCGGCCTTTGTCCACGACATCGCA
CCGGCAGGCGCAGCCAAGCGGTTTCTGCTCGCCCGCCTGGGCCAGGAAAGACCCGCCGAG
ATCAGCGCCGATCTGTTTCTGCTGGGTCGCAGTACACCGGCACCCATTGGCAACATGCGA
ATAAAGGAATCGGCGGAAGCAGTCGATGAGAGGAAGCCGATCGGATTCAAGCGCGAGGAG
ATCATTAGCCGCGACAACCGCTTTCTTGAATATGCCTACGAGCTGGGCGCGGCCATCGGT
GGCGCGACGGGGGCAGGTGGGGAAGCTCCGAAGCTCTTACTGGCAGAGAACAGCGCCGGG
CTTCTGTATCCCGATGCGGTATTGGACGATGAAGAAGTGCGACAGCACTGGTTCGTGAAA
TTCGCCAGAAACAGGGGCGGGCAGACCGACCAGGACATCCTGCGCAGCGAATTCCATTAC
TACAAAGCGCTGCAGACATTGGGCATCGAAACGGTCGCGGCAGAAGGCCTGGCCTTGGAA
GAGGCGACCAAACCGAGTTTGTGGATGCGGCGTTTTGATCGACAAGTGAAAGATGGGGCG
GTGTCGCGTTTCGCCGTCGAATCGATTTATTCGCTGGCTGAAGTGACGACGCCAGGCAGC
GCCATGAATCATCTGGAAGTGATCCGCATGCTCGCCGGGCTCTGGCGCAAAGCGGGTCAG
GCCAGCCAGATTCCCGGCCTCGTCGCCGATTATCTGCGTCGCGACCTGATCAATAAAATC
CTCGGAAACTCCGATAACCACGGTCGTAACACGGCGATCATCCGGCAAGAGAACGCTTTC
CAGCTCGCGCCGATTTATGACCTCGCCCCGATGGTCATGGATGACGAAGGCGTGACGCGT
ACGACCAAATGGCCAAAAGAGTTGGAGCGGGCGGGAGATGTCGATTGGCGAGGTGTCTGC
CGCGTATTGGCCGATAGCGCAGATCCGCACGAATCTTTGACGGGGCTGGATGCCTCGGCG
CTGTTCGAAGGCTTGCGCGCGGATGCCCGCCGTCTGGCCGCACTGCCGGATATTCTTGCG
GCCAGCGGTTTGCCCGCCAGAACCATGAATCACCCGAGCGTTCATCTGAAAAACCTCGAG
CAACGTTTGAAAGAGTGGGACCTGCAATGA