METABLE2 Genes

PROKKA_00053 SelectedGram+

GenomeSelectedGram+ ctg_1:64174-64452
ProductCDS hypothetical protein
Inferenceab initio prediction:Prodigal:2.6
Sequence
>PROKKA_00053 hypothetical protein
ATGAGTCTGACCGTCCTCGAGCGCACGGCGCTCATCGAAAGCATTCAGCAATCACTGGCC
GAAGGCACTCTGGAAATCGGTGACGCCGTGCGCCGTTTACGGGTCGAAGTCACCGGTCTG
CATCAGACCCAGTTCGCGAAGATGTGCAAGATTTCAGTGCGCACGCTGGTGCATATCGAA
CATGGCGAAGGCAATCAGACCCTGAAGTCGCTGAACGCGGTGTTCCGCCCCTTCGGCATG
AAAATGGGCGTAGTGCGGATTCGCCGGGACACCATTTGA