METABLE2 Genes

PROKKA_00058 SelectedGram+

GenomeSelectedGram+ ctg_1:67904-68350
ProductCDS putative acetyltransferase
Inferenceab initio prediction:Prodigal:2.6,protein motif:CLUSTERS:PRK03624
Sequence
>PROKKA_00058 putative acetyltransferase
ATGACTCAGATCGATATTCGCCCGGTCAGCGCCAACGACCACGCCGCTTGGCTGCCGCTA
TGGCAGGCGTACCTGCGCTTCTACAACACGGAACTGCCAGACGCCGTCACCCAAAGCACC
TGGCAGCGCTTGCTCGACCCGAATGAACCGACCCACGCCGCCCTCGCGTGGGCCGATGGC
AAAGCATTGGGCATGGTGCATTACATCTATCATCGCTCGAACTGGAGCATCGAAAATTCC
TGCTATTTGCAAGATCTGCTGGTGGTGCCGGAAGCCCGTGGCACCGGTGTCGGTCGGCTG
TTGATCGAGCATGTCTACGCTACCGCCAAGGCCGATGGTTGCTGCAAAGTCCACTGGCTG
ACCCATGAAACCAACGCCACGGCGATCCAGCTCTACGAGCGCATTGCCGAACGTCCGGGA
TTCATCCAGTTTCGTAAAGCCCTTTAA