METABLE2 Genes

PROKKA_00061 SelectedGram+

GenomeSelectedGram+ ctg_1:70585-75189
ProductCDS hypothetical protein
Inferenceab initio prediction:Prodigal:2.6
Sequence
>PROKKA_00061 hypothetical protein
ATGACCGCCATTCCCAAAGCCAGTGCCGTCGATATCGTGACTCAGCTGGTTACTGGCCCC
TCACTGCAGGAAGTCGCTTCAAAAACGCTGCGCGATGCCCTCAAGACGCTGTATCCGAAT
CTCGACATAGACCCGCGTCTGGCGATGGTCGTGCAACCCACCTGGGCCATTGTGGATGGT
CGAGTCGTACCCGATGGGTATCAGGCTGGATCGCTGACCAACGCCCTGGTGCGGCTCGGC
CTGTCCGGCACCACGGTGACGTACCTTGATGGCGAGCATTATCTGACCCTGCAACCCGGC
ATGCCCGCACCCGCGCATCTGCCGGTAAAGATCGATGCCATCGGCCTGTTGCTCAACGAA
CTGGCGCCACTGCTGTTCATCGCTTACAAGGAGCAGCACGTCGAATACTGGGACGAGTTC
ACCTACCCCGGGCAACCGCGCTGGCAGCAATTGTCCGAGGCACTGCGCAACCTCTGGAAC
GTCGATGCCAGCGTCGGCTGGGAACCTGACGAGATCGCCATGGCCCGGGCGATTTTCAAA
CAGCCCGACCCGCAACAACGCCTGGCCCCCGCCCCGTACTCGGCAAAGGCATATCTGATT
GACCTCGATCGCGGTGGCGCCGACACGCCATCGCACTTGACCGTGGTCGATGCCGCAGTA
GTGATCGGCACAATCGCAGACCGCAAGTTGATTCTCACCCACGCGGTCACCCAGGGCTTT
CAGCGTTTCGATTCACTGGAGGAACTCGGCGAGGCTCTGCTGCGGATATATGGCGCAAGC
GCCTCGGGCGAAGATCTCAAGTGGCGGCTGGTCGAACCCCAGGGCAATTTCTTCGACCAG
CAGGCGTGCACGCTGATTTCCATGGAAGCGGATGCCTTGGGCGAAATCAGTTTTTTTCAG
GATTCCCCTGGTCAACGCGTCTATCCGCATACCGGCACGGCCGGCAAACCGGCACAACCG
ACACCGCGCCTCGAAGCGCACTTCGAGCGTTTGCAGCCGATGCTTCCGGACTGGCTGAAC
GACGCACTGCCCATGGATCAGACGCGTTACAGCCGGCACCTGCTGGATCTGACAACGCTG
CAGCACGAAAACAACGGCAAATCCTTTCAAAGCGAAATCACCAGCCTGCAGGCGTTCACT
CGTGCAGCGCTGATCAGGCAGATTCTCAAGGAGCAGCCCGGCGCCAAAGACGTGAACATC
GACAACATCGAAATCACCATCACCAGTCTCGTGGTCTGGGGCACGTTTGTATTGCCGGGA
AATACTCAGGCTCAGACATGGACGCTGACCGAGCTTGCCCTGCAAAACCTCGCAGGCCTG
CCGTTGGGCAACAAGACTGTGCGGTACAAGGATGGCAGCCCGGTACCCGAGTGGATGAGC
GCGACTTTTCTGGAAAAACTGGTCAGCACGGTCGACATCGGCAAGACCTACCCGGCGCAT
CTCAAGGCCATGCTGCTAGACGACCCCGTGCAAGCGCCGCTGTTGCAAGGGCTCTACACC
AGTCAGCTGCGCATTGAGCTGCCATTGCTGGCGTTGCAGCACAAGATCCGGGGTAAAGCC
GGCCTCGATGAATCGGGTTATCGATACGTGGTCGCCGCATTCGCCACGACTGGCGCGGAA
CGCTACGTCGATGGCGAGGAAATCGTCATTCGCCCTTTGGCCTTCGTCGCTCATCGCAGC
CGCTCCACCGCAGACACTGTCGACAACATGTATGTCATAGGCCCGCGCGATGCCGACAAA
GGGCCGTGCGTGCTGTATCGACCGCTGTTCGACAAGACTCTGCTGCAATATCCGGGGCCC
GCGAATCTGCTTTTTGCGATCCAGCATTCGCGACATTTGCGTGACTCGGTACTGGCCTGG
TTGCCGGACGATGTGCGCTTCAATTACAGCCAGTTCGTCTTTACCGCCAGACTGCCGTCG
GTGTGGACGATCCCGCAACTGATGATCAATCCGACCACTGCGCTGGATATGTCAGGCGCG
GTCGCGCTGGGCACTCAGGTGATCGCCAGCGACGTCCTCGCAACCCTGCACGAACGCAAC
GTAAAGGCGCTTGTCACTCAAGCCGACCGGCAGTCTGTCTCCGACGCCGAAGCACGCTGG
GCCTCGCTGAAACAGGGCGGCTGGGTGATGCTCAATGCCGCACTGCCGTTCCTGGGCCGC
AGCGTAGGCACAGCGGCGTGGATCTGGCAGATCATGGATGATCTGCAGGAAATCACCGAC
GGCGCCAACGAGCAATCGGGGAAGATCGCCTGGACGGCCATCGCCGATATTCTCCTGGCG
CTGGGCATGGTGCTCGCCCACCGTGCGGCGGTGGGCGATGCGCCATCGACACCCGTGGCC
ACGGAGCTCGAAGAGGACCCAGCGACGACCAGACCTGCCGCCAGAATCGTCAAAGCGCTG
CGCCAGCCCGATATCACCGGCCCGCAATTAACCCAATTCCATGGCACATCGATCGACAGC
ATCACGGCGCTGAAACGATCCCCGACGGCACTCGCCACGCTGTTGGACGGGTTCAAGGTC
GGCAAGCCCAAAGCCCTTGGCGCAGCCACCCGGGAAGGCGCGTACCGAGACCTCTACGCC
CACGCAGACAAATGGTACGCCCGGGTCGGTGAGCGCTGGTTCGAAGTCGCGCGCAACGTG
CATGGCGATGTGCACATCGTCGATACGCGTCAGCCCACCCGACCAGCCGGGCCCAGGCTT
GCCTATACCGCCAATGGCCAATGGGTGATAGATCTGCGTTTGCGCCTGCGCGGAGGCGGG
CTGGAGGACGGGCGCAAGGTGGCGCAAGGCAAAAAAAACCAAGAGGTGGCCGTATTGTCC
GAGCAGATCACCGCGTTCGATTTGACGATGGAGAGCAAAGGCAGCCGTCTCGATACCGAA
CGCAACAGCCTGCGCGATGCCCCTGCGCAGGCACGCGAACAAGCGCTTGCGCAGTACCTC
GCCACGCTCGATTCACAGCACAACGAATATGCCGCGAACATTCAGCTGATCAAGACACTC
AACTGCAAGCAATCGATTCCCAACTACCGCACGGTCATGCCGGAGCGGTTGGACATGCAG
TTGTTCCTGGGGCAGGAGTGGCTCAGTAATAACGCTTCGGATTACCAGCAACGCGTGCTG
AGGGTGCAGGCGATACTGGACGACGAACTGCGCGGCGAATCGCAGGCGGTCACCTCTGCG
TTCGAACAGTTGAACGATGCCACTCAAACCATCATCGAGAAAATGGAGTCGGCTGAAGCC
TGCCTGGATGAACTGACCAGGCTGGGACCTGATGGCCTGGAGATAAAGCAGAAATACAAC
ATCAGCCTGGCGCCCTACCCGCTGGATGATCTGAAGACTCTGCAGATCAGTCTCGGCCAG
TACACCTGCATCAAGCCCGGCGATTCCACCGCTCATGTCGAGGCGCAACAAGCGCTGGCC
AGTCTGTTCGAAGATGCTGCGCTGAACGTTCAGAGTTCGCGTGACCTGAGCGCCGATGAA
AGCCTCAGTGATCTGCGCATACGCATCGACGCCCTGAGTCAGGTGAGCGAACAGTTCGCT
TCCGTGGACAAGCGTTTCGATGACCTAGCGAGTGAATATTCCGAACACATACACACGGAA
CGACTCAGGCAATTGCAGGCGCGCGTGGCCGCATTCAAGGATAGCGCCGACAACCGACTC
GCCGACCTGTTGCGCTACCGGCATTTACTGGTGCCGCAAGCCGGTCCGTCGAGACCCTCA
ACGTCAGCTTCGAATCGGCAGATCATCAAGACACGCAACAAGGGCACCCTGGTCGGCCAG
CGGAAAAAAAGCCTCGACGGCAAGAACACCGATCTGGTCGAAGTCGGTACGGCGCTGACG
AGAGTGATCGCGACATTCAAGGAGGAATCGCCAGGTATCTGGGTCGAGCAGAGTGCACGG
CCTGCACCGTTGCCTAAAGCCAGGCCCAACCTCAACAAGAGCATCAGCGAAGGGCAGGCA
TTGATCGACGGGCTGGCGGCGTTTCATCGGCGCATCGAGGCGCGTCTCAAACGCGGCTCG
CGCATTCCAGTGGAGGTCGAAGAGGAATACCACAATCACGCCACCCTGTTGCGCAAAGCC
TGTGCGGCGATCGATGAAGCGTTAACGGCGAGTAACCTCACCGCTGCTCTGCATGAACCG
TCCGAAGAGCTCAACCACAAGCTCGACGCTGCGGCTACGACACTGGAGCAAAAAGGCACC
AGCACGCGAATCCGCCTGGTCAAGCAACAACTGCCAACAGCTGCCGGGGTCGAGTGGCTC
AAGGACAAAGGCGAAGTGAACATCTCGAAAACCCTGACCCGACGGCGTCTGAGGCGCCAT
CAGAACGATTTTCTCGACGAGTATCAGATTCGTGATGCGCATACCGACAAGGTCCTCTGC
TATGCGCATTTCCATTACAGCAGCGTCGACGCGCCCGTTGGTGCATTTGTGCGTGGACAT
ATGAAAACGCTCGCTCAGCACCGCATGGGGGGCGTCGCCGAAATAACGGGTGTGGATAAT
CAGAGGCTGATTGAAATCCATCGCAGCGAAATTTCCAGTCGCAGCGCCGAAACGCTGTTC
TTCAATCTTGCCAAGCCTGCCGCAGACGCGACAGCGCCGCTTTGA