METABLE2 Genes

PROKKA_00071 SelectedGram+

GenomeSelectedGram+ ctg_1:86467-86712
ProductCDS hypothetical protein
Inferenceab initio prediction:Prodigal:2.6,protein motif:CLUSTERS:PRK10457
Sequence
>PROKKA_00071 hypothetical protein
ATGGGAATTATCGGAACCATCTTTATCGGCTTGATCGTCGGCCTGCTGGCACGGTTCCTG
AAACCGGGCGATGACAGCATGGGCTGGATCATGACCATCCTGCTCGGTATCGGCGGTTCG
CTGGCCGCCACCTACGGCGGCCAGGCTCTGGGCATCTATCAGGCGGGCGAGGGCGCTGGT
TTCCTCGGCGCACTGGTCGGCGCTGTCGTGTTGCTGGTGATCTACGGTCTGATCAAAAAG
AACTGA