METABLE2 Genes

PROKKA_00072 SelectedGram+

GenomeSelectedGram+ ctg_1:86806-87342
ProductCDS hypothetical protein
Inferenceab initio prediction:Prodigal:2.6
Sequence
>PROKKA_00072 hypothetical protein
ATGCGCCGTCTTCTGTTTCCTCTCCTCTTGCTGGGCAGCTATCTCGCCCACGCCGGCGAA
CTGCCGGAAACCGACTGGCTGGAACTGATGCCCAAGTCGGATCAAAAGGCCCTCGAGGCC
ATGCCGGAAATCGACCACAACTCCCCCGAAGCCACCGGCACCTTCACCGAGAAGGGCGGG
ATGAAGCAGGCCAAAGGTCTGCCGGCGGTGATGTATTCGAAGAAAACCGTGGCGTCGATG
AACGACAAGCACATTCGCATCGGTGGTTACCCGGTGCCGCTGGAATCCGACGCCAAGGGC
CGCAGCACGCTGTTCTTCCTTGTGCCGTATCCGGGCGCCTGCATCCACGTGCCGCCACCA
CCGCCGAATCAACTGGTGCTGGTGCGGTATCCGAAAGGGTTGAAGCTGGAGGACATCTAC
ACACCGCTTTGGGTGACCGGCACGCTTAAAATCGAAAAGGTCAGTAATGACCTGGCGGAT
GCGGCGTATGCGCTGGAGGCGGAGAAGGTGCGGGTGGTGCAGGAGGCTGACCTCTAA