METABLE2 Genes

PROKKA_00074 SelectedGram+

GenomeSelectedGram+ ctg_1:88385-88789
ProductCDS putative acyl-CoA thioester hydrolase
Inferenceab initio prediction:Prodigal:2.6,similar to AA sequence:UniProtKB:P44886
Sequence
>PROKKA_00074 putative acyl-CoA thioester hydrolase
ATGATAGAGCTCGAACAAGAAGATCCGATCCCACAGGGCGACCTGGCCCTGCAAATCACC
GCACTTCCCCGCGAAACCAACGGCTTTGGCGATATTTTCGGCGGCTGGCTGGTCGCGCAG
ATGGATCTGGCCGGCACTGCCATGGCCAGCCGGGTGGCCGGTGGCCGCGTTGCCACTGTC
GCCATCGACCGCATGGCGTTTCTCGTCCCGGTCGCGGTCGGCGCGCAGTTGTCCTTTTAT
ACCCAGACCCTGGAAATCGGCCGCAGCTCGATCCAGATGATGGTCGAAGTGTGGAGCGAT
GACCCACTCTCCAGCGAATGGCGCAAGGTCACCGAAGCGGTTTTCGTTTTCGTCGCCATC
GACGGCAGCGGTCGCACCCGTTCGGTGCCGCCACGCGCGCGTTAA