METABLE2 Genes

PROKKA_00086 SelectedGram+

GenomeSelectedGram+ ctg_1:103761-104144
ProductCDS Secreted repeat of unknown function
Inferenceab initio prediction:Prodigal:2.6,protein motif:Pfam:PF03640.9
Sequence
>PROKKA_00086 Secreted repeat of unknown function
ATGACTCAGATGACTGCTTCGTTCAAAGCCCTGCTGCTGGCCGCCGCCCTGACAATACCG
GGGCTGGCCATGGCGGCCGATCCGGCGATGGAAAAGGACGGCATGTACACCGACCACAAG
GGCATGACCCTGTACACCTTCGCCAAGGACTCCGCTGGCAAGTCCGCGTGCAATGACAAG
TGCGCGGCAAACTGGCCGCCGTTGATGGCGCAGGCGGGTGACAAATCCATGGGCGACTGG
ACGGTGATCAAGCGTGACGACGGCACGATGCAGTGGGCCTACCAGGGCATGCCGTTGTAC
ACCTTCGTGATGGACAAGAAGGCCGGCGACATGACCGGCGACGGCAAAATGGACGGCGCC
TGGAAAGTCGCCAAGGCCAAATAA