METABLE2 Genes

PROKKA_00092 SelectedGram+

GenomeSelectedGram+ ctg_1:107795-108163
ProductCDS hypothetical protein
Inferenceab initio prediction:Prodigal:2.6
Sequence
>PROKKA_00092 hypothetical protein
ATGGGCACTAGCTTTTTCAAAAAACGGATCACGATTCCAGCCTTAATTTTGCTTTTTATC
AGCACCTCTGTTTCGGCTGAAATGTGCATCGCAAAAATTTGCCTGTTTAAAGGCCCTTTA
TCATCAACGGGGGCTATGTTGCTCTTCACAACAACCGTGCCGTTTTATACGACGTCGGAA
GAAATCAAAAGCCTTTCGAAGCACTATGTGCAAGCTGTAAAGGACGACGCCACTACATAT
ATCGCTACGGACGGAGAATTCGACGGGGCCATGCTTGAATCCGCATGGCGTGCATATCTC
CATCAAAATACCGAGCAAAAATTAAGCAAGAGAGATTTTGCCCATATGGTTTTGGCTACC
TATGGATAA