METABLE2 Genes

PROKKA_00093 SelectedGram+

GenomeSelectedGram+ ctg_1:108247-110577
ProductCDS Lipase (class 3)
Inferenceab initio prediction:Prodigal:2.6,protein motif:Pfam:PF01764.1
Sequence
>PROKKA_00093 Lipase (class 3)
ATGAACGCCGAATCCTTACCGACAAGCGTTACCGCCTTCATGCAAGGTGATATCCACGCC
TGCCCGATGCGCGGGCATTCGACCAGTTTTCAATTGGTGAATGAGTTCGGAGACGGCACA
CCCTACGCCGGCTTGGCATATGAGATCACCGACTACGAAGACACCGTTCATACTGGAAAA
CTGGATGCGAAAGGCTGGGCAAAGGTAAACAACCACCATTGTGGCCCGGTAGTGCTCAAG
CTGAATAAGCCTTTTCAAGGAGCAGACGCGCTGTATCGAGACTTGAGAAAAAGACTGGAC
TACCCCCTCCCCATTACCGAACTCCAAGTCCGCGCCGAAAAGACCCGCTTCTTCCATAAA
ACAGGTACTCGCACCCAGGCCAATCCGGCCAAGGACCTGCCCGAAACCGACGCGTACTGT
CAGGTCGAAGTCAGTGAACTGGTAAAACACATCGCCCACTTGCCGCCGCTGGCTGCTCGT
CGCGACGCTCCGAAGAGGGCGGCGCACAAGCTCATGCGCCCCGCTGCGAAGTCCAGAGAC
TTCACGGTCGTCGATAAAACTTCTGCGGATGGCGGACTGCACACCATCTTGAGTGCGGCG
GAGATGGCCACCGTCGAGTTGGGGTTTTCCCCGCCGCCGCCCAAGGGCGTCGCACTGCTG
CCGAACAAACACCATGTGCTGGAAGTACGGCCGATGAGAGCGCTACGGCCAATGCTGTCG
ACAGGCGAAGCGTTCTGCGCGCTCAACCTTTATCAGCTGTCGGTGATGGCGACGCTGAGC
TACACCGATTTCGGGCAGGAACCCAACACTCAACCGGTGCAGACCGACACGGTAAGCTTT
CCGCTACAGCCCAGCAGCGGCAACTGGTTCGGCCACGCGCTGCCGCAGTTCGACGAGTTG
TGGAAAGTCGATGACTCGCAAACGCAGAAATACTACCCACTGTACGAAGACGTACCGTAT
TCGAAACGCCTGGAAGTGGTGCCGTTCGACCCGAACCTTTACCCCGAAGTGAATGACCCC
GCGTTAGGGAACCAACAAGAACACCCCACCAGACTGCATTTTTTCGATGATCGCAAACAG
GTCGAAAGCACGGACACTCAGGCCTTCATCTGCCACCACGACGAACTGATCCTGATCAGC
GTACGCGGTACCAGTGAGATCTGGCCCGACGGTCTGCGTGATGGAGATGCCTATCAGGTT
CCGTTCCAGGAAGGAGAAGGCAAAGTGCACCGCGGTTTCTACGGTGGCGCTTTGGCGGCT
TATCCATTTATCGTGACTTATCTGGAAAAATTCTACAGCGGGCAAAAGCTGCTGATCACG
GGTCACAGTCTGGGCGGTGCAGTTGCACTGATCCTGTCCGAGATGCTGAGACGCAACCTG
GAGTTCTCCCCGCAAATCGTGCTCTACACCTACGGCGCCCCCCGCGCCGGCGACACCACC
TTCATCGAAAGCGCCAGATCGCTGGTGCATCACCGCATCGTCAATCAGAACGATCCGGTA
CCGAGCGTGCCGGCGACCTGGATGAACACCTTTGCCAAGCCTGGACCGATGTACGCAACC
AACGCCGTGGTGCTGGGCTTCACCCCGGTCGCCGGCCTCGGCCTGCTGATCTGGGGAATC
ATCAATTTCTTTGGCGACGACTATGGGCATCACGGTGCTTTGCGCCATTTCATGCCCGTT
GAGTTCGACAAGGACCACCGATCCTCCCTTCTCTGGGAGCCGGGTTGCAGCACGATCGTC
GATCACGGCTGCGCCAAGGCCCTGCGCGCTACCAACGGCTTGCCCGAACGCGGATCGTTT
CTGCGGCAGTTGTTCGACCGGGGTCACCACTCAATGGTCGGCAGCTACATCCCCGGCTGC
TGGGCCAGCTTGCGCCGTTGGCAGGAAGCACTGCAGCTCAAGCGTTCGCTGGTGACCAAT
CGCGAATTCGAGTGGATCAGCAGCGCGCTGGAGAATATTCAGCAACAGCTGCGGGCCGTT
AAGCGCGATCTGCAAAACAACCACCGTTCTTACGTGCGAGAGCAGGAGCGCGCGCACAAG
ACGCTGATGCTCAATCAGGAAATAGACAAGATCAGCATGACCAAGGCCCGCCTGACAGCG
CTGCGCAGTCAACGGGTCACTGAGACCGACGTTTACGGCAGCTATGCCGACCAGCCCGAA
TGGGTTGAGGAAAGTCTGCTGCGCTGGAACGCCCACCCTGAAAACCTGGTTCAGGAGCAA
CTGGCGATGATCCCGCAAGCCGCTGAAGACCACGACGCCGCTATCGCCGCGATGACCGGT
GGGCATGCAGTTGGCGCGCCGTTTCATCTGGATATTGATTCGATTGTGTAG