METABLE2 Genes

PROKKA_00094 SelectedGram+

GenomeSelectedGram+ ctg_1:110574-111365
ProductCDS hypothetical protein
Inferenceab initio prediction:Prodigal:2.6
Sequence
>PROKKA_00094 hypothetical protein
ATGAGGAACTTGAAACGAGGGTTGCTGCTGAGTGGTTGCCTGGGATTGCTGGTGGGTTGT
ACGACGGTGAAGACCCCGAACACCTTTATGTTTGTTCCGGATTTTCCACCTGGATTCAAG
TACGACCTGACGGCCACCTATGTTCCGGCCAAGGGCCAAACATGCACTGTGCCTGGCGGG
AGAAACACTCAGCTGGGATACAACAAAACCAATATGAAGTACCAAGGGACTTCCGAGATC
CCGCTGTACAGAACCGTAAGCGAATGTCCGCTGGCGCTGAATTACATCGAGATCAAGGTC
ATCGGTATTTATGGTTCAGGGCGAAGCAACTTCAGCTATGACTACGCCTCGATTGCTGTA
CGCCCGGAGTTGCTGGAACGACAGATGGGGACTTTCAGTGAGGACGGCAAGGGTGAGTTT
ACAGGCGAATGCATGTGGTTTTTTCGGACAGTCAGCCCCAAGCGTAACCTAATAAAAATG
TTGAGATGTAAAGGAATGGATCAAGAAGGAAATGTAGCCCGGAGCCGCCCTCATGGCGCG
TACACACTGGATCAACTCCCAGGAAAAACCGTGAGGTTGAAAATAAACCTAGCGAATGAA
GAGCAACCTGGTTGGGGGGACACTTGGGTCCAGGTTCCTGGTGGCTGGAAGCGCTGTATG
GGGGAAGGCTATGAGGACCAGCGTGGTTACTGCAATGGAAATTATGAAGACTTCAGCACC
TTCAGAATGGTTGATGGACGGATTTGCACAATCTATCCAAGTTGCAATGAAAACACGGAC
GAGACTCCATGA