METABLE2 Genes

PROKKA_00095 SelectedGram+

GenomeSelectedGram+ ctg_1:111362-112210
ProductCDS hypothetical protein
Inferenceab initio prediction:Prodigal:2.6
Sequence
>PROKKA_00095 hypothetical protein
ATGAGCCCGGTCGAACAATGGTTGCACGCTCAGTCCAGCGCCGGCTGTGAACTGTATCTG
ATGCTCGACACCGACGGCCACAGCGCAGAGCACGCTGCGTTGACCCGCGACCTCGGCACC
GAGCGGTTTCGTCCGCTCTACACCGGCACGCCGGCCGAGTCGCTGGTGCCGACCGGCCCG
CTGCTGTTGCAGATCGATACGGCGCAGCATCCCGCGATCCAGACCTTGCTCGCCACGCCC
GAGCGCAATTGGGGCTGGCTGGCCAGTGCCCGTCACGTCGAACTTGATCTGCTGGCGGCG
CATTGGCGCGAGCGCCTGATAACCGGCGAACGCCCGAATCAGGCGGTGTACCGCGTGCAT
GACAACCGGGTTCTGGGCCGTGCGCTGGCGCACCTGCAACCCGAGCACCGCGCGGCGTTT
CTCGGGCCATTCAACAGCGTCTGCTATTGGCACGCAGAGCGATGGAACGCCATCGACAAC
CCGGACCCCGGCCACCACCCGCTGCCGATGGATCCGCCGTGGCTGCACACGCCGACCCCG
GAACTGATCTACGCCAACGTGCTGTTCGACAACACCCGCCGTTACCTGGTCGGCGAACAC
ACCGAAGCCATGGCCACGCTGGCCGAACAACTCGATGTCGATGAATGGTTGTGGGGCCTG
ATTCAACTGACGCACTTGTGGGGCTGGCAACAACCGGAGCAAGTGCATTTCTTGCTGACG
CGCAGTTTGCAGTTACCGGGATATCGGCCAGGCAAATCATGGCTGCCCAAACCCGGTGAA
GATCCGGCGATGCATTTTGAGCGGGTATATCAGGAAGCGTTGTATTGGCAGGGAGAGGTA
GGTCGATGA