METABLE2 Genes

PROKKA_00096 SelectedGram+

GenomeSelectedGram+ ctg_1:112207-114231
ProductCDS Phage-related baseplate assembly protein
Inferenceab initio prediction:Prodigal:2.6,protein motif:Pfam:PF04717.6
Sequence
>PROKKA_00096 Phage-related baseplate assembly protein
ATGTTCGGCAAAGGCCACTGCGCGCCATTCTCACTGCATATCCCGGCCATTCGTCACGAC
TTCAAGGTGCTCGCGTTCACTGGCACCGAAGCGATCAGTCAGCTGTACGCATTTCGCATC
GAGCTGGTGAGCGAGTACGCGGACTTCGATCTGGAAAGCCTGCTCAGCCAGCCTGCTTTT
CTGCAATTCGGGTTAGCGGGCGAAGGCATTCACGGGCGGATCGAAAATGTCATGCTCGGC
GAATCGGGAAAGCGCCTGACCCGCTATGAGCTGTCACTGGTACCGGCGCTGCATTATCTG
CAAATGAGCCACGACCAGCGGATTTTTCAGCAACTGACAGTGGCGCAGATCATCGCGCAA
GTGCTCAAAGGGCATGGCATCCAGGCCGATGACTTCACGTTCAATGTCGCCGCCGGTGAG
CCTCGTGAGTACTGCACGCAATACGGCGAAAGCGACTTCCTGTTCATCCAGCGCCTGTGC
GCCGAAGAGGGTATTGCCTGGCACCACCAGCATTCGCTCGACAGGCACTTGCTGGTGTTC
AGCGACAGCCCGGTGTTCGCGCGCAAATTGGGTACCACACCCTTCAGGGTCGATAGCGGC
ATGGTCGCCGAACACCCGGTGGTCAACCACCTGAGCATGGGCTTCAACACCCGTACCAGC
ACGGTCACCCGCCGCGACTATGACCTCAAGCGCCCAAGCCTGCTACTGGAAAGCCGCTTC
ACCGCAGAATTCACGCCGGCTCTGGAGGACTATCGCTATCCACTGCTGATCAAGTCCGAG
AAGCACGGCAAACAGCTGGTGCGTCAGGCATTGGAGCGCCATCGCAGCGACTATCAATGG
ATTGAAGGCAAAAGCAATCAGGCGATTTTGCGCAGCGGTCACCTGTTCAAGCTGAGCGAA
CATCCCAGGGCCGACTGCAACGAGTTGTGGCTGTTGGTCAGTCTTAGTCACGAAGGCAAG
CAACCGGCAGTGCTCGAAGAGGCTTTCAGCAGCGAGGCGAAACCTGCCGATGGTTTTTCC
CAGGGCTATCGCAATACCTTCAGGGCCATTCCCGCAGAGGTGGTTTACCGCCCGCCTTTG
CCCGCGCCAAGGCCCTTGCTGGTCTGCCAGACCGCGCGCGTTACCGGGCCTCCCGGAGAG
GAGATCTTCTGTGATGAATACGGCAGGGTTCGTGTCGAGTTTCCCTGGGATCGCGCTGAA
CGCAACAGCGAAAAAAGCAGCTGCTGGTTACGCGTAGCGTCCAGTTGGGCAGGTGACGGA
TTCGGTGCGGTGACCATTCCCCGGGTCGACATGGAAGTGGTCGTGACCTTCCAGGAAGGC
GACCCGGACCAACCGCTGATTACCGGCTGCGTCGCCAACAAGGTCAATGCCGTCGCTCAT
CCCTTGCCGGCGAGTAAAACCCGCACGGTATTACGCAGCCAGAGTTCGCCGCGCAATGGC
GGCTACAACGAGCTGTCGATCGAGGATCGCGCCGGGCAGGAGAAAATCTGCCTGCGCGCG
CAGCGCGACCTCGAGCAACTGATCCTCAACGACAGCCGCAGCCTGATCACTCGCGACCGC
CATGAGCATGTCGGCAATGACAGCACCAGCCTTATCGAAGGCAGGGATTCGCGCACTCAT
CAAGGGCTGCGCAGCACCGTGATCAACGCCGATGACTTGTTGCAGGTCAGCGGCACCAGC
AGCCAGACCCTGGGCGCTCTGGTGATCCAGGCCGGCCAGCAGGCGCATGTCACGGCAAGC
AACGTGGTGATCGATGCCGGCATGAGCCTGACGCTGTCAGCGGGCGGCCATCACATCGTG
ATCAATGCCGGCGGGATTTTCAGCAGCGTGCCCATCGTTCAGGGCGGCGCGCCACTGCCG
GGGCTCGCACCGCTACAACCGCTACAGGCAGAGGCTGGCCTAGTTCTTCCGAACAGCGCC
ACACCGCTGTCGATCGTCAACAGCGCCCGCCAGCAGGCAGCGGATTTTTGCCCGCTGTGC
GAAGCCTGCGCGGCGGGTCAGTGCGAGCTGGGAGAAGTCGCATGA