METABLE2 Genes

PROKKA_00097 SelectedGram+

GenomeSelectedGram+ ctg_1:114703-114927
ProductCDS hypothetical protein
Inferenceab initio prediction:Prodigal:2.6
Sequence
>PROKKA_00097 hypothetical protein
ATGGCCTTTATTAAGGATTACAGTCATGCGCGCGAATGGAGTTTCAGCAACGCGGGACAG
TATCGAAGAGCAGTTCAGCGACTCATCCAATTGAGATGTGCTCTTTCAAGTGGGCGCATC
GTAATCACTATGATGGCCACTAGCAAGCATCTGATTAAACAACAAGACGAACTGTTCATT
GCGGTCTGTAGGAGATCGCCCTATATATCGCAGGGGTTTCCCTGA