METABLE2 Genes

PROKKA_00098 SelectedGram+

GenomeSelectedGram+ ctg_1:114930-116492
ProductCDS hypothetical protein
Inferenceab initio prediction:Prodigal:2.6,protein motif:Pfam:PF06812.6
Sequence
>PROKKA_00098 hypothetical protein
ATGTCCTACTCAAGCAAACTTTCCGCCCATTACCTCGAACTCGCAAAAGTCTCTGTTTCC
AAAGAGAATTTCGCGGGCGAAGACGTTCGTTTTTCGATCGAATTCGAGGCGCTGGAAAGT
GAGCTGGCCAAGGCTTCGTCGATGCACGAAAGCGGGCAGATCGACTGGCTGAAAATCCGC
GAAAACAGCGAAAATCTGCTGCGTACCCAATCCAAGGATCTGCGTGTCGGCGCCTGGCTG
ACGTGGTCGCTATACCAGCGCGAATCCTTCCCCGGGCTGCTTGCCGGCCTCGGTCTGCTG
CACCATCTGTCGGAAAACAACTGGGCCGACGTCCACCCGCTCAAACCCCGCACCCGTGCC
GCCGCGATCGGCTGGCTGGTGCCGCGTCTCGAGCAGGTCATCACCGAAAACATTGCGATC
AAAGAGCAGTTGCCGATGTTCCGGCAGCTCTCTGAGCACCTGGCCGGCCTTGAGGCCGCG
TGCACTGAACATCTGGGCGATGACGCGCCACTGCTGCTGCCGATCTCCCGCCGCCTGAAA
ACCATGATTCAGCGCGCCGCCGACAACCAGCCGGCACCCGGCGTGGTGGGCGCGGCGGTG
GCGCAGGTCAAGCAGGCCGCGACCCAGCTGCTCACTCCTGGCGCACCGATCGACAACGAG
CGGGATGCGCACAAAGCCCTGCGCGCCCAGCAGGACAGCGCCCGGCCGTTGTGTGCCTGG
TGGCTCAAGCAGAAGGCTACCGATCTGCGTGCCCTGCGCCTCAATCGCACGCTGTTGTGG
ATGACCATCGACGCGGTGCCCGAGCGCAACGCCGAGCAGATCACCGTGCTGCGCGGTCTG
CCGCTGGAAAAACTCAAGCTCTATCAGGACCGTTTCGATCAGGGCAAATACGCCGACCTG
CTGGTGGAACTGGAGGCGAGCCTGGCGAAGGCGCCGTTCTGGTTCGATGGCCAGAGGATG
GTCTGGGAATGTCTCCAGAACCTCAACGCCGAGCTGGCCATGCGCGAAGTGGAAATCCAC
TTCGCGCTTTTGATTCAGCGCCTGCCGGGCATCATCGAGTTGCGCTTCCATGACGGCGCG
CCGTTTGCCGATCCGTCCACCCGGGCGTGGATCGCCGCCAATGTCATGCCGCACCTGCAA
AGCGCCAGCGCGCCGCGCAAGGTCGAAAGCGAGAACGTCGAAACCCAGCCGGCCTGGGAA
AAAGCCCTCGAGGAAGTCCAGCCGATTCTGCGCAAGGAAGGTTTGAAGCCGGCCGTGCAG
ATTCTCAAGCAGGGTCTGCAATCGGCCCACGGTGGTCGCGAACGCTTCTTCTGGCAGTTC
ACCCTCGCGCGGCTGTGTTTCCTGGCCAAGAAATACGAACTGGCCAAGAACCAGCTCGAA
ACCCTCGATCAGACATTACAGGACTCAGGCCTGCACGCCTGGGAGCCCGATCTTGCATTG
CAAGTGCTGCACCTGCTGCACAGTTGCTGCGAGTTGTTGCCGCAGAACCACGCCGTACGT
GAAAGCAAGGAAGAGATTTATCGCAGGCTGTGCCACCTCGACCTCGAAGTGGTACTCGAA
TAG