METABLE2 Genes

PROKKA_00099 SelectedGram+

GenomeSelectedGram+ ctg_1:116525-117028
ProductCDS hypothetical protein
Inferenceab initio prediction:Prodigal:2.6
Sequence
>PROKKA_00099 hypothetical protein
ATGGCCAAAGAAGGCTCGGTAGCCCCCAAGGAACGCATCAACGTCACCTTCAAACCCGCC
ACCGGCGGAGCTCAGGAAGAGATTGAACTGCCGCTGAAGCTGCTGGCAATCGGTGACTAC
ACCCACCGCAAGGACGATCGCAAAATCGAAGATCGCAAGCCGATCAGCATCGACAAGATG
ACCTTCGACGAAGTGTTGGCCAAGCAAGAGCTGGGTCTGACGCTGAGCGTGCCGAACCGT
CTGCAGGAAGATGGCGAGGCTGAAGAGCTGGCCGTGCAATTGCGCGTCAATTCGATGAAG
GACTTCAACCCGGCCAGCCTGGTCGAGCAAGTGCCTGAGCTGAAAAAACTGATGGAACTG
CGCGATGCGCTGGTGGCCCTCAAAGGCCCGCTGGGTAACGCACCTGCGTTCCGTAAAGCG
ATCGAAGGCGTGCTCGCCGACGACGAATCCCGCGGTCGCGTACTCGGTGAGCTGGGCCTG
AACGCCGCAGCCCCGGACGCCTGA