METABLE2 Genes

PROKKA_00100 SelectedGram+

GenomeSelectedGram+ ctg_1:117057-118532
ProductCDS hypothetical protein
Inferenceab initio prediction:Prodigal:2.6
Sequence
>PROKKA_00100 hypothetical protein
ATGAGCACTAGCGCAGCACAAGAGAAGAGCGCCGCCAGCGGCGAATACAGCATTCTCGAC
AGCATCATCGCCGAAACCCGTCTGACCCCGGACGACGAAGCCTACGACATCGCCAAGCGT
GGCGTGTCGGCGTTCATCGAAGAGCTGCTCAAGCCGCAGAACAACGGTGAGCCGGTCAAG
AAAGCCATGGTTGACCGCATGATCGCCGAGATCGATGCCAAGCTCAGCCGTCAGATGGAC
GAGATCCTGCACCACCCGGATTTCCAGGCGCTGGAATCGTCGTGGCGTGGTCTGCAGTTG
CTGGTCGACCGCACCAACTTCCGCGAAAACATCAAGATCGAAATCCTCAACGTCTCCAAA
GAAGACCTGCTGGACGATTTCGAAGACTCGCCGGAAGTCATGCAGTCGGGCCTGTACAAG
CATATCTACACCGCTGAATACGGCCAGTTCGGTGGTCAGCCGGTGGGCGCGATCATCGCC
AACTACTACATGTCGCCAAGCTCGCCAGACGTCAAGCTGATGCAGTACGTGGCCAGCGTT
TCGTGCATGTCCCACGCGCCGTTCATCGCTGCCGCCGGGCCGAAATTCTTCGGTCTGGAA
AGCTTCACCGGCCTGCCGGATCTGAAAGATCTGAAAGACCACTTCGAAGGCCCGCAATTC
GCCAAATGGCAGAGCTTCCGTACCTCGGAAGACTCGCGCTACGTTGGCCTGACCGTGCCG
CGTTTCCTGCTGCGTAACCCGTACGATCCGGAAGAAAACCCGGTGAAATCGTTCGTGTAC
AAGGAAACCGTTGCCAACAGCCATGAGCACTACCTGTGGGGCAACACCGCTTACGCGTTC
GGCACCAAACTGACCGACAGCTTCGCCAAATTCCGCTGGTGCCCGAACATCATCGGCCCA
CAGAGCGGTGGCGCGGTTGAAGACCTGCCGTTGCACCACTTCGAAAGCATGGGCGAAATC
GAAACCAAGATCCCTACCGAAGTACTGGTTTCCGACCGTCGTGAATACGAACTGGCCGAG
GAAGGCTTCATCTCCCTGACCATGCGCAAAGGCTCCGACAACGCGGCGTTCTTCTCCGCC
AGCTCGGTGCAGAAGCCGAAGTTCTTCGGCATCAGCGCAGAAGGCAAGGCGGCAGAGCTG
AACTACAAGCTCGGCACCCAACTGCCGTACATGATGATCGTCAACCGTCTGGCTCACTAC
TTGAAAGTGCTGCAGCGCGAGCAACTCGGTTCGTGGAAAGAGCGTACCGACCTCGAGCTG
GAACTGAACAAGTGGATCCGTCAGTACGTTGCCGACCAGGAAAACCCGAGCGCCGAAGTG
CGTGGCCGTCGTCCGCTGCGCGCTGCGCAAGTGATCGTCAGCGACGTTGAAGGCGAGCCG
GGCTGGTACCGCGTGAGCTTGAACGTGCGTCCGCACTTCAAGTACATGGGTGCCGATTTC
ACCCTGTCGCTGGTTGGCAAGCTGGACAAAGAGTAA