METABLE2 Genes

PROKKA_00101 SelectedGram+

GenomeSelectedGram+ ctg_1:118542-118949
ProductCDS Gene 25-like lysozyme
Inferenceab initio prediction:Prodigal:2.6,protein motif:Pfam:PF04965.8
Sequence
>PROKKA_00101 Gene 25-like lysozyme
ATGGACGGATACGGCAGCCTGTTCGAACGCCTCAACGGCGACGCACAACTACGCAAGGGC
AACAGCCTTGAGGCTTGCGCCATGGCGTCAGTGGCTGCCCATCTGGCCAAAATGCTCAGC
ACCCGGGCCGGCAGCGTGCAAACGCTGGCCGACTACGGGTTGCCCGATCTCAATGACATG
CGCCTGAGCCTGCACGACTCCCTGAGTCAGGCCCGCCTGGCTATCGAAAACTTCATCGAA
GCCTACGAGCCACGCCTGAGCAACGTGCGTGTCATTTCCCTGCCGCGTGACCACGATCAA
CTTCGCCTGGCCTTCAGTATCGAAGGCCTGCTGGAAGTCGAAGGGTTCAAGCGCCAGGTC
AGTTTTTCCGCGCGCCTGGATGGCAGCGGTCAAGTGAAGGTGAATTAG