METABLE2 Genes

PROKKA_00102 SelectedGram+

GenomeSelectedGram+ ctg_1:118969-119400
ProductCDS hypothetical protein
Inferenceab initio prediction:Prodigal:2.6
Sequence
>PROKKA_00102 hypothetical protein
GTGAATCCGGGTGCGTTGGCGAAGTGGGGGCGTGGCGTGTTGCTATTTCTCGCCCTGACG
GCTGCTGCCCTCGTTTCAGCTGCCTGTTACGTGAAGACGACGGCGGCACGGCTGGCTCAC
GAGTACTCCACCGACTGGAACGATGCGGGTACGTGCTTCATCCGCTCCTACATTCCGCAG
TATTCGGCCCTCGGCATACCGGGAATGATTTTCAAGCTGTTTGCCAGCGAAGCCTTTTTC
CGGGTCTACGCAAAAGACGGCACGCTGCTGAAATCGTCCGAATGGTTGCTCTGGCAGAAC
GAGTTCACCACCGATGAACGCTCGCAATGGGTATACGGTCACGCGATCTACCCGACAGTT
ACGGGTTACGAAGGCTGGAATATTCCAGCGTGTGGTCAAGAAATGAACAGTCCTCAAGCC
AAGGTCAACTAA