METABLE2 Genes

PROKKA_00103 SelectedGram+

GenomeSelectedGram+ ctg_1:119412-119936
ProductCDS PAAR motif protein
Inferenceab initio prediction:Prodigal:2.6,protein motif:Pfam:PF05488.7
Sequence
>PROKKA_00103 PAAR motif protein
ATGTCTGGCAAACCCGCAGCACGCGTATCCGACCCCACCGCTTGCCCGCTCCCCGGCCAC
GGCACCAACCCGATCGCCGCCGGTTCCGGCGACGTGTTCTTCGACGGCCTCGCGGCCGCC
CGCCAAGGCGATGCCTCGGCGTGTGGTGGTGCGATGTCCGGCGGTTTGGCGACCACTGTG
TTGATCAACGGCAAGCCTGCCGCGACGGTTGATTCGGTGGGGACTCATGGCAACAAGGTC
ACGGCTGGGTCCGGGACGGTGATTATTGGCAATTCGCATTCGCCGGCGCCGTTTGTTCCG
CCGTTGCCGGTGGAGATTCAGTGGCCGTTTAACGAGCACTTTGTGATCAATTGCGAAGAA
ACAGGCAAACCCCTTGCAGGCGTGGAGTACACACTTAAAACCGCATCGGGGAAAATCATA
AACGGCGTGACTGGCGCGGATGGGAAAACTCAAAAAGTATTCTCCGCTACTGCAGAGGCA
ATTGAGTTGATTATCGAGCCTCAGAGCAGAGTCGTGCTCGCTTAG