METABLE2 Genes

PROKKA_00002 SelectedGram-

GenomeSelectedGram- ctg_1:301-810
ProductCDS hypothetical protein
Inferenceab initio prediction:Prodigal:2.6
Sequence
>PROKKA_00002 hypothetical protein
GTGCGCCGCCAGTACTTCACCCCGCTGCGCGCCGCAGAAGATCGCTTCCGGCAATTCTTT
TTCCAGCGCCGAACGCTGCGGGCCGTCACCGACCACGATCAGCTTCAGATGGCGCTGTGG
ATAAGTCGCAGACAGGGTTTCAAAGCAGCGTTTGAGCAGGCCCAGATTTTTCTCCGGGGC
GAGCCTTCCTACGTGGATGACCGCGATATCCGTGTCAGAGAGCCCCCATTGCTCACGCAA
CGCGCTCTGACGTTTGCTCGGATGAAACAACTGGCTGTCCACACCCCGCGACAACAACGC
CAGCCGCTCGAAATGCCGCCGCTCCAACTCCAGGCGCTGACTGGCGCTCGGCACCAAAGT
CATTGCCGAACGATTGTGAAACCAGCGCAGGTAGTGGGTAAGCATCCGCGTCAGCAGACC
GAGGCCGTACTGGCTGGTGTACTGCTGGAAGTTGGTGTGAAAGCCGCTCACCACCGCAAT
CCCCAGGCGCCGTGCGGCGCGCAGTGCTGA