METABLE2 Genes

PROKKA_00003 SelectedGram-

GenomeSelectedGram- ctg_1:1187-1939
ProductCDS putative sulfate transport protein CysZ
Inferenceab initio prediction:Prodigal:2.6,protein motif:CLUSTERS:PRK04949
Sequence
>PROKKA_00003 putative sulfate transport protein CysZ
ATGCCCGCCCCTGTTCTGTCAGGCCCGCAATACCTGCGCGAAGGCCTCAAACTGGTCCTG
AGCCCTGGCCTGCGCCTGTTCGTGTTGTTGCCGCTGGCTATCAACCTGGTGCTGTTCGTC
GGATTGATCTATCTGGCCGGCCACCAGTTCAGCCTGTGGGTCGACACGCTGATGCCCTCG
TTGCCTGAATGGCTGAGTTTCCTCAGCTATATCCTGTGGCCGCTGTTCGTGGTCCTCGTG
GCCTTGATGGTGTTTTTCACCTTCACCATGCTCGCCAACATCATTGCCGCACCGTTCAAC
GGTTTCCTCGCGGAAAAAGTTGAAGTGGTGGTGCGCGGCACCGATGATTTCCCGGCGTTC
AGTTGGGGCGAACTGATCGCGATGATCCCGCGCACCCTCTCCCGGGAAATGCGCAAGCTC
GGCTACTTCCTGCCGCGCGCCATTGGCCTGTTCATCCTTTCGTTCATCCCGGTGGTAAAT
ATCGTCGCCGCGCCGTTATGGCTGCTGTTCGGCGTGTGGATGATGGCCATCCAGTACATC
GACTACCCGGCGGATAACCACAAACTCGGCTGGAACGAGATGCTCGCCTGGCTGCGGCAG
AAGCGCTGGCAGAGCATGAGTTTTGGCGGGATCGTCTATCTGGTGTTGCTGATTCCGGTG
GTCAACATCCTGATGATGCCGGCGGCGGTAGCCGGGGCGACATTGTTCTGGGTGCGCGAA
CGTGGCGCCGAAAACCTGGTGATACAGCACTGA