METABLE2 Genes

PROKKA_00005 SelectedGram-

GenomeSelectedGram- ctg_1:3405-3743
ProductCDS HopJ type III effector protein
Inferenceab initio prediction:Prodigal:2.6,protein motif:Pfam:PF08888.5
Sequence
>PROKKA_00005 HopJ type III effector protein
ATGACTGATCTGAATACCCTGCGCGCCAGCCTCAAGAGTGGCGAGCATGCTTTCGCCGAC
ACCCTGGCGTTCATCGCCGCCGGTTACGACTACCAGCCGCAAGCATTCAACAACGGCGGC
GTGGAAAATGCTGCCGGGCAGAACGAAGGCTCCTGCAAGACCCTGGGTCTGGCACTGCTG
GAAGGTTTGAGCGATGAAGAAGCGCTGCTGGCGTTCGGCGAGCATTACCGTTCGGTCCTG
GCGACGCCCGAGGGCAGCGATCACGGCAACATTCGCGCGTTGATCAAACACGGCCTGGCC
GGGGTCAAGTTCAGCGCAGAACCACTGACCCGCCGCTGA