METABLE2 Genes

PROKKA_00006 SelectedGram-

GenomeSelectedGram- ctg_1:3736-4032
ProductCDS hypothetical protein
Inferenceab initio prediction:Prodigal:2.6
Sequence
>PROKKA_00006 hypothetical protein
ATGACTGATCAACAACGCCTGGAACTCGAAGCCGCCGCCTTTCGCCGACTGGTCGCTCAC
CTCGACAGCCGCAAGGACGTGCAGAACATCGACCTGATGAACCTCGCCGGGTTCTGCCGC
AACTGCCTGTCGAAATGGTACAAGGCCGAAGCCGACCAACGTCAGATCGAGGTCAGCCTC
GATGACGCCCGCGAAGTGGTGTACGGCATGCCCTACGCCGAGTGGAAAGCCCAATACCAG
CAAGAAGCCAGCGCCGAGCAGCAAGCAGCGTTTGCCAAAGGAAAACTCAATGACTGA