METABLE2 Genes

PROKKA_00009 SelectedGram-

GenomeSelectedGram- ctg_1:5335-5904
ProductCDS hypothetical protein
Inferenceab initio prediction:Prodigal:2.6
Sequence
>PROKKA_00009 hypothetical protein
ATGTCTACTTCCCCCGTCACGCTAATGGTAGCGCGTCGCGTCGCTGATGGCCGTTATCAC
GATCTTATCGCCTGGTTGCGCGAAGGCGAGCAACTGGCCACCGACTTCCCCGGCTACCTC
GGCTCCGGCGTCCTCGCGCCACCGCCCGGTGACAACGAATTCCAGATTATCTTCCGCTTT
GTCGATGAGCAGACCCTGCACGCGTGGGAATACTCGGCGTCGCGTACCGCCTGGCTTAAC
CGCGGCAGCGATTTGTTCGAACATCCTAAAGAGCACCGGGTCAGCGGCATTGAAGGCTGG
TTTGGTGCTGCCGGCCAACGCCCGCCGCGCTGGAAACAGGCCGTGGCGATCTGGCTGGCG
TTTTTTCCGGTGTCGCTGATATTCAACTTTGCCCTCGGCCCGCTGCTCGCTGAGCTGAGC
CTGTTGCCGCGCATCTTGATCGGCACGGCGTGCCTGACGCCGCTGATGGTGTATTTCTTC
ATCCCGTTGTCGACGCGTCTGCTGGCGAACTGGTTGAACAGCACGCCGACGAGGCCATTG
GCTGGCGCACCGTCGGCGCAGAATCGCTGA