METABLE2 Genes

PROKKA_00011 SelectedGram-

GenomeSelectedGram- ctg_1:7079-7684
ProductCDS hypothetical protein
Inferenceab initio prediction:Prodigal:2.6
Sequence
>PROKKA_00011 hypothetical protein
ATGCAGCGCGACGCCCTCCTCACCCAGGACGAGCTGGATTTCATCCAGACAATGCAGCAC
AACCCGCAACTGAACGTGCGGGATGCGACGTCGAGTCTGCTGGTTAATGGTGGTTCGCAG
ATCCGTGACCTGCTGACACGTCTGGCTGCTCACGAGCAGGTGACGATCCAGGCCAACTTC
GAAAATCAACAGATGACTTTCCCGCTGCATCTGGTGGAAGACGAGTTCCACGCGCTGCAT
CTGCGTCTCGGGGTGCCGAGCATCTACGAAGACGGGCCGATGGTGCGCCCATGGCGTCTC
GTACTCGAGGAGCCGGTGGCATTGGAAAACGCCAAAGGCCAGCCCGGCACGCTGTGGGTG
CACGAGGTGTCGCACAAAGGTGTGTTGCTGGAAGTGCGCAACAAGACCAAACCACCGAAA
CATTTCGCCCTGTGGTTCAGCCCTTCCGGTTATGAGCGCATCTCGTTGCGCGGCCATTTC
GAGCGTGAAACCGAGCAAGGTTTCTTCGCTTACGAACTGAGCCAGACCGATGCCGACGAA
ACCGAGCGCCTGCGCCAGTTCATCCTTCAACAGCATCGCCTGACCCATCCCGCCCTGCAC
GCCTGA