METABLE2 Genes

PROKKA_00016 SelectedGram-

GenomeSelectedGram- ctg_1:10838-11749
ProductCDS Putative short-chain type dehydrogenase/reductase
Inferenceab initio prediction:Prodigal:2.6,similar to AA sequence:UniProtKB:P96825
Sequence
>PROKKA_00016 Putative short-chain type dehydrogenase/reductase
ATGAATGAACCTGTGCGTTTCGAAGATAAAGTCGTGATTGTCACCGGCGCCGGTGGCGGC
CTCGGTCGTGCGCATGCTCTGCTGTTCGCCAGACAGGGCGCCAAAGTGCTGGTCAACGAT
CTCGGTGGCTCGACGCAGGGCGAGGGCGCCAACGCTTCGGCTGCCGACCGCGTAGTGGCG
CAAATCCGCGAGGCCGGCGGTATTGCCGAAGCCAACCACGACTCGGTGACTGACGGCGAC
AAACTGGTACAGAACGCCCTTGATGCCTTCGGCCGCGTCGACGTCGTAGTCAACAATGCC
GGGATCCTGCGCGACAAGTCATTTCACAAGATGGACGACGCCGACTGGGATCTGGTCTAT
CGCGTCCACGTCGAAGGCGCCTACAAGGTTACCCGTGCCGCCTGGCCGCATCTGCGCGAG
CAAAACTACGGTCGCGTGATTTTCACTGCATCGACTTCAGGCATCTATGGCAATTTCGGC
CAGTCCAACTACGGCATGGCCAAACTCGGGCTGTACGGGTTGACCCGAACGCTGGCGATC
GAAGGGCGCAAGAACAACATTCTGGTCAACGCCATCGCCCCGACCGGCGGCACGCGCATG
ACCGAGGGCCTGATCCCGCCGCAAGTATTCGAGCAACTGAAGCCGGAACTGGTCAGCCCG
CTGGTGGTGTATCTGGCCAGCGAGCAATGCCAGGAAACGTCCGGCCTGTTCGAAGTCGGC
GGCGGCTGGATGGGCAAGGTGCGCTGGGAACGCAGCCTCGGTGCCGGCTTCGATCCGCGC
GAGGGGTTCTCGCCGGAAGACGTCGCGGCGCACTGGCAGCAGATTTGTGATTTCGAAGGG
GCGGCGCATCCGAAGGACAATATTGAAGCGTTGAAGGAAATGATGGCGAATTTGCAGAAG
TATTCGATTTAG