METABLE2 Genes

PROKKA_00018 SelectedGram-

GenomeSelectedGram- ctg_1:14078-15352
ProductCDS hypothetical protein
Inferenceab initio prediction:Prodigal:2.6
Sequence
>PROKKA_00018 hypothetical protein
ATGCGCAAAACGATTCTGCAATGTGGCGTGCTGGCCTTGAGTCTGCTGGCGGCCAACGTG
ATGGCGGCGGTGTCGCCGGATGAAGCGAACAAGCTCGGCACCAGCCTGACCCCGCTCGGC
GCCGAGAAGGCCGGCAATGCGGACGGATCGATTCCGGCCTGGACCGGCGGCATCCCGAAA
AACGCCGGTGCGGTGGACAGCAAGGGCTTCCTCGCCGACCCGTTTGCCAACGAAAAACCG
CTGTTCACCATCACCGCCGCGAACGTCGAGCAGTACAAAAGCAAGCTCTCCGATGGCCAG
GTGGCGATGTTCAAACGCTACCCGGAAACCTACAAGATTCCGGTCTACCCCACCCACCGC
ACTGTGGGCGCGCCGGCGGAAATCTATGAGTCGGCCAAGCGCAGCGCGCTGAACGTCAAC
GCAATCAACGACGGCAACGGCCTGGCCAATTTCACCGGCAACCGCTACTACGCCTTTCCG
ATTCCGAAGAATGGCGTCGAAGTGCTGTGGAACCACATCACCCGCTACCACGGTGGCAAT
CTGCGGCGCATCATCACCCAGGTCACACCGCAGACCAACGGCAGTTACACGCCGATCCGC
TTCGAAGAAGAGATCGCCGTGCCGCAACTGATGAAAGACATCGACCCGGATAAAGCCGCC
AACGTGCTGACGTTCTTCAAGCAATCGGTGACCGCTCCGGCGCGGCTGGCCGGTAACGTG
CTGCTGGTGCACGAAACTCTCGATCAGGTGAAGGAACCGCGTCTGGCGTGGATCTACAAC
GCCGGTCAGCGCCGCGTACGTCGCGCGCCGCAAGTGGCCTATGACGGCCCGGGTACAGCG
GCCGATGGCCTGAGGACTTCCGACAACTTCGACATGTTCTCCGGTGCTCCGGATCGCTAT
GACTGGAAACTGGTCGGCAAGAAGGAAATGTACATTCCCTACAACAGCTACAAGCTTGAC
TCGCCGAAGCTCAAGTACGACGACATCGTCAAGGCCGGGCACATCAATCAGGACCTGACC
CGTTACGAACTGCACCGCGTCTGGGAAGTGATCGGCACGGTGAAACCGAACGAGCGGCAC
ATCTACGCCAAGCGCCACATGTACATCGACGAGGACAGCTGGCAAGTGGCACTGGCCGAT
CACTACGACGGTCGCGGGCAACTGTGGCGCGTTGCCGAAGGTCACGCCCAGTACTACTAC
GATCATCAGGCTCAGGCTTACACGCTGGAAGCGCTCTACGACATCATTGCCGGCCGCTAC
ATTGCGTTGGCATGA