METABLE2 Genes

PROKKA_00019 SelectedGram-

GenomeSelectedGram- ctg_1:15349-15444
ProductCDS hypothetical protein
Inferenceab initio prediction:Prodigal:2.6
Sequence
>PROKKA_00019 hypothetical protein
ATGAAGAACGAAGAGAAGCACAGCTTCGAATTCGGTTTTGAAGCCAAGGCTGCCGATTAC
ACACCTTCGGCCCTGCGCGCCGAGGGCGTGCGCTAA