METABLE2 Genes

PROKKA_00021 SelectedGram-

GenomeSelectedGram- ctg_1:18288-21752
ProductCDS hypothetical protein
Inferenceab initio prediction:Prodigal:2.6
Sequence
>PROKKA_00021 hypothetical protein
GTGGCCAAGTTATATAAAAGTTTGATGCGTGGTTCTTTCGGTGAGCAGGTTACCTGGCCG
GAAGAGTGGGAAAAGGCAACACAGGCTAAAACAGATCTGTTCAAGATCATCGACGCCATG
CCGAGCGTGCTGGATATTCTGCGCAGCATGCTTGAGGGTGAACTGAAGCGTCTGGGCAAA
ACAGTTGATATCGACAAGGTCTATATCAATACGGATCCTGCTTTCCCTGCCGATGAAAAT
CGGCCATCAGGCACTCTTTGGGAGGTAACGGTTCATTGTCTGAATAACCATATAAGTCCT
GCCTATATTATGGGTGGCGATGGGGTTTTTGTTCTGCCGGATACGTTCAGTGAGCAATTC
AAAGTCAACGTGCTCAATACCATTGTTGTTGAAGATCTGATCGCTGCTGTAACTGCCGGA
CTGGAAAAAACATTGCGAGCCGAGATCGCAAAGTTCTGGGCTGCGCCAGCGAAACCCGTC
CATGCCGACAATGCACCGCTGTCGAACAAACAGGCTTTCATCAAGGCCTATGCCGTGGTC
ACCGGTGCAGAGCTGTCGCTGTCGGTCATGGCCAACAATTTCGATGCCCGATTGGGCGAG
CGATTCGCTCATCTGCTGGAAGCAGATGCCGGTCGCGCAGCGTTTGAAGTCAACCTGCAA
CCGGCACAGGATTATCTTCTGGTGCGCCAGCCCTGTTTCGTTCTGGACAACGCCGAGCGT
GCGGTCGCAGAGATGCAACTGGTCAACGAGTCGACTTCCTATTTGCTGCACACGCCGGAA
AACGGCTTTGAGTTCTTTGAAAAAAATACCGATTTGCACAGCAAACTTCAGCAGAGACTT
TCCCTGCGTAGCGAGCAGATCAGTTATCCGAAAGCCACGCAAAATCCTCATGCGTTTTGT
GCAGAGGCTCACCTCAAAGGTCAGCTTGAAAGCGTGGCAACCTTGATCAGTGGCCGGGCA
CAACTGGAAAAACCGCTGACCTCCATGCTTCAGGAGAATCAACGCCTGCATGTGCTGCGT
TACGGCATCGACACCCGCTTTTATCTGCTTTGGGCAGCACTGAAGCGCACCGACTGGCCG
CTTTGGCTGCATGCCGCTGGTAGCGATGTTCAACAACGTTATAGCGAGCTTGAAGAATCC
AAAGACCAGTATGAGGCTGCATATTCGAGCGCGTTCGATACGTGTTTTTCTTTCAAGGAC
TATGTGGTGCGCACGTTCGCCGCATGGGCGCAGAGGGCCTTTGACGAACGTCTGGATCCA
GAAGCGATCAGTGTCCATAGCTCGTACACTTTGCAGATTGCCGGACGGACCATCGAGCAA
GAAGAAACCCGGACGCTGACGGAGTTTCTTGTTTTCGGTCTGCACGACAATGGTTACAAA
GCGACTCTGACCATCATCGGCGCTCCCGACGGAAGTCGGCTGACGGCAGTAGCGCTCGAG
CAGTGGCTGGAAAATCGTAACCTGCGCCTGGAGTTTACCGGCAGTCTTGCATACTCGACG
TCGGTTGCTTGGCAGGAGGCCTATCGCAACTATCTCTTCAGCCAGATGGAGTTTGCAGTT
TTTGTAGCTCGCCAGTCCGGGAAGCTGGATTCCACCGATGCGAACATCATCGCGCGAGCC
ATGGCCAACGACCCTGCGGTGACTATTCAGGGCTTGAAAATAAGGCTGCAAGTCCCAGCA
TTGAAAGATGTTCTGATGATTTCGGCCAAAGAATACGCACCGTCGCTGATGTTGGTCAAA
ACAGCTGACGGGCAATTCGAACTGCAGAAATTTTCCGATATCTACGCGGCGAACCGCTGG
CTGGAGTCGGCATTGTCGGCGGATCGTGAATACGCCGCATTGATGATTCATCCCGACTAC
CTGCACGAGGCGGGTGAGTTGCTTGGCAGCGCTGGTACTCAACTGAGCTACCGCTACACG
CTTGATAGCCGGCCGGTCGATCTTTATCTGAACGCCAAGGCACCTTTGGCGGACTACGTA
AATGTCGCCTACCGAGCCGAAGTTGCGCTGCACAAGGCCATTGCACCGGCAGCTTATCGG
GCGCTTGGCATTGAGGGGCGCAAGCGCTATTCGCGTCTGACAACCGAACTCAAGGCGCTG
TCCACGGTTGATGCACGAGACAATGGTTTTCCGACATTCGAGCAGTTCACCTATGACGCG
GTGAAGGCCCAGATAGAAGACCTATTGCGTTCGCGCGGCAGCAACATTTCGGTCAATCCC
GACCAGATCATTATTCAGACCGAAGAGTTTCGTAAGAGCGTTACCGACGTCTTGCTTGAG
GGACTCGCTTTCGAAGCGGTGCATCCGGCCTATGAAACCAAGTACAGCCCCAAATATTAC
TTGGTGAATGGACATCCCCTCGTTGAAAAACTGGATATCCGGGATTTGTCTTCGCTATCG
AAAACCTTCCGCCCTGGTGACCGATACAGCGCGATGCTGGAAGAGCAATATCTGAACAAG
GCTCATCCTGATTACGCTTTCAAGCGCGCGGTACATGCCCGGAAAATCCGCTGTGAGATG
TATCGCAATGCGTTTGCCGATTTCACCAACGGCAGATTATCGACAGAGTCTTTCTCTGCT
GTCCAAGGGGTTATCGATAACCTCAAAGAGAGTGGCGGTTATCAGTCGGTAGGGACCAGC
ACCGCCGAAGGTGATATCGGGCTGTACAAATTCAATATTGGCGCGCTGGGTCTGACGACT
CCTGGGGACCGCGCGGTTGGCGGCGTTTATATTTTTCGACTGAAGTTGTCGTCAGGTTTC
TTCGACTTGCTCTATACGCCTGACGCACCGGATCAAGTCAACTTCCGGCCGATCGCTGAG
TTCGTTCCTTCGATTCGTTTTCGAAAAGGCCCGTTCAGGAACTATTACAGCGAGCGGATA
CTGCTGGTTGACCAGAAAGTGACCAATGACTACTTCGATAATCTGGTCGCAACGGTTGAT
ACCCGACCGGTCATTCGCACACAGCAGCGTTCGTTACTGCCCGATCTGTTCACTTTCCAT
GACGAGCGAGTGCGCCGTGTATTGAGTGACATCGACGAACGGACCACCAGTCTCAACGAA
ATAATCGCCGGTGTGGTTTATGAAAATCTGTTGAAGGCCGCAAACATTGTCAGCCTGCTG
GTGCCACCCGTAGGCACTGTGGTGGTGGCTGTGCAGGTGATGAAAAGCATCTACGACGCG
TCGCAGTCGCACCGACGTGGTGATTATTCCGCCGCGCTGGGGCATGTGCAGGATGTATTG
AGCGGACTGCTGACATTGGGTCAGGCTGCAGCGGCGGGGGCGCCGGCTAAAGAACTTACC
CGTGCGCAACGCTCGTTTCTGAGTTTGTTTGAAGACGCCCGCACGGTCGCGGAGCTGGTT
ACGTATTACACCGGCCATGAAGACCCCGCCGATGAACTGATCGGGTTCTTCAAGGCACTG
ATGCAAGAGGCTGAGTCTGCATTAAGCAAGACCACGGTTCGCTGA