METABLE2 Genes

PROKKA_00024 SelectedGram-

GenomeSelectedGram- ctg_1:24030-25334
ProductCDS Ureidoglycolate lyase
Inferenceab initio prediction:Prodigal:2.6,similar to AA sequence:UniProtKB:Q39BA7
Sequence
>PROKKA_00024 Ureidoglycolate lyase
ATGACACAGAATTCCATCCCCCGCAGCTGGGTCGCTTCGGCCAACGGTCACAGCGATTTC
CCCTTGCAGAATCTGCCGCTGGGCGTGTTCAGCCTGGACGGTTCGGCGCCTCGCGCGGGC
GTAGCGATCGGCGAGCACATTTTCGATTTGCAGGTGGCGCTTGAGGCCGGTCTGTTCGAC
GGTGTCGCACGCAGTGCGGTGGAAGCCATGCACGGCGGGCAGTTGAACGCGTTCTTTGAA
CTTGGCCGTGAGGCGCGGGTGGCCCTGCGCGAACGCCTGATCGAACTGTTCAGTGAAGGC
AGTACCCTGCGCGGCAACATCGAAGCGCAAGGCGCGAAACTCTTGCCGTTGGCTGCCGAT
TGCCAGATGCACCTGCCGGCACGGATCAGCGATTACACCGACTTCTACGTCGGCATCGAG
CACGCGCAGAACGTCGGCAAACTGTTCCGCCCGGATAACCCGCTGCTGCCGAACTACAAG
CACGTGCCGATCGGTTACCACGGTCGCGCTTCGACGGTGCGAGCGTCCGGCACCGACGTG
CGCCGGCCGAAAGGCCAGACGCTGCCGGCCGGGCAGACCGAACCGGTATTCGGTCCATGC
GCGCGTCTGGATTACGAACTGGAACTGGGCATCTGGATCGGTCAGGGCAATGAGATGGGC
GAGCCGATTGCCATCGGTGACGCCGCCGAGCACATCGCCGGGTTCTGCCTGCTCAACGAC
TGGTCGGCGCGGGATATCCAGGCTTGGGAATACCAGCCACTCGGCCCATTCCTGTCGAAG
AGTTTCATCACCAGCGTCTCGCCCTGGGTGGTAACGGCCGAAGCGCTGGAGCCTTTCCGT
ACTGCACAACCGGCGCGCCCTGAAGGTGATCCGCAGCCGCTGCCGTATCTGCTCGACAAG
CGCGATCAGGATGGCGGCGCCTTCGACATCGAGCTGGAAGTGCTGTTGCGTACCGAAACC
ATGCGCGAGCAGAACCTGCCCGCCCATCGTTTGACCCTGAGCAACACTCGTTACATGTAC
TGGACCGTGGCGCAAATGGTCGCGCACCACAGCGTCAACGGCTGCCAGTTGCAGGCCGGT
GACCTGTTCGGTTCGGGCACTTTGTCCGGCCCGGAAAACGGCCAGTTCGGCAGCCTGCTG
GAGATTACCGAGGGCGGTAAGAAACCGATCGAACTGGCTTCCGGCGAAGTGCGCAAATTC
CTTGAGGACGGTGACGAAATCATCCTGCGTGCCCGCTGCGCCCGCGACGGTTTTGCCTCG
ATCGGCTTCGGCGAATGTCGCGGCACCGTGATCGCTGCGCGCTGA