METABLE2 Genes

PROKKA_00026 SelectedGram-

GenomeSelectedGram- ctg_1:26074-26877
ProductCDS hypothetical protein
Inferenceab initio prediction:Prodigal:2.6,protein motif:CLUSTERS:PRK10941
Sequence
>PROKKA_00026 hypothetical protein
ATGAGTGCGCGCCAACGCTTTTTCGAATGCCTGCATCGTTCACCGCCAGCCCTGCTGGAA
GCTGCGCTGTGGATAAGTGCCGAGCACGACAAAACCCTCGAGCCCGAGGCATGGTTGCGC
ACCTTCAAGGATCTGCAACTACGCGTCAGCTATGGGCTGCCGATGCTGCCGGTCAGCGAA
CTGGCGCAACCGCTGTTGCGGCGCATGGTCGATCTCGGTTTCGCGCAGGATGATTTCCTG
CCGCTGCGCCCACAGGCGGCGCTGTTGCATCGCGTGTTGCACACCCAACGCGGTCAGCCG
TTGGCATTGGCGTTGATCGCACTGGAACTGGCGCGTGGGCTGGAGATTCCTCTGGTCGGG
GTCAACTTCCCCGGACATTTTCTGCTGCGGGTACCCGGCGCCGACCACTTGCTCGACCCT
TGCGGCGGGCGGCGACTGTATCCCAATGACTGCCGAGAACTGTTGCAACGCCAATACGGG
CCGAACATGCAGCTCAGCGCCGAACATTTGCTGAGCGCAACGCCGGTGCAGATGCTGCAA
CGTCTGTCACGCAACCTGCGCCAATTGCACCTGACCCACGACGATCACATCGCCGCGCTG
ATCGACGCAGAACGAGTGCTCGAACTGGGCGATGCGAAGGCCTCCGATTACATGGCCCGG
GCCAGTCTGTATCAACGGCTGGATTGCCCGAACGCTGAACGCTTCGATCTGGAGCATGCA
TTATTGCTCAGCGAAGACCCGATCCAGCGCCTGCGCCTGACCGAACGCCTCGGCCATCTG
TCGCCCAACTCCGTCGTGCATTGA