METABLE2 Genes

PROKKA_00028 SelectedGram-

GenomeSelectedGram- ctg_1:28156-28491
ProductCDS DNA damage-inducible protein YebG
Inferenceab initio prediction:Prodigal:2.6,protein motif:CLUSTERS:PRK10061
Sequence
>PROKKA_00028 DNA damage-inducible protein YebG
ATGGCCGTCGAAGTGGTATACCGCAGCAGCCGAGATCTGGAGCGCTTGTTCATGGATAAA
GCCGAAGCTGATCGTCATGACAAAATGCTCGAACTGGCCGAATATCTGGCCGATGTGCTG
CAAAAAGCCGTTCCGTCTCTGACCGAACAGCAAGTGGAAGAAGCCGGGATCTACATGGCG
AAGAATCGTGATGTGTTCGCCCGGGCGTTCAAGAGCCAGCCCGATGCGCTGTCGGAGCTG
ATCAATGCGCCGGCCGAGCCTGTCGAAAAAGCTGAAGCGGCAGAACCTGATGAGGCGCCG
GCGAAGCCAGCCAAAGCAGCGAAAGCGCCGAAGTAA