METABLE2 Genes

PROKKA_00029 SelectedGram-

GenomeSelectedGram- ctg_1:28839-29339
ProductCDS phosphate-starvation-inducible protein PsiE
Inferenceab initio prediction:Prodigal:2.6,protein motif:CLUSTERS:PRK02833
Sequence
>PROKKA_00029 phosphate-starvation-inducible protein PsiE
GTGAAAATAAATTGGGCCGAGAAACTGCGGCGTAACGTGCATCAACTGGCCGAGTCCCTG
GGCAACCTGTTCGTCGAAACCTTTCACTATCTGGCGCTGTTCGCCATCGGTGCGGTGACA
GCGTGGGCGGCGGTGATGGAGTTTCTCGGGATGCTCGAAGTCGGGCACATCAAGATCGAT
GACATTCTGTTGCTGTTCATCTATCTGGAACTGGGCGCGATGGTCGGGATTTATTTCAAG
ACCAACCACATGCCGGTGCGCTTCCTGATCTACGTGGCGATCACTGCACTGACGCGCCTG
CTGATCTCCAACGTCTCGCACCACAACCCGCCGGACATGGGCATTATCTACCTGTGCGGC
GGCATTCTGCTGCTGGCGTTTGCGATCCTGGTGGTGCGTTACGCTTCGTCGCAATTCCCC
TCAGTGAAGATCGAGAACCCGCAGCGCAAGCTCGGCACGGGCTCCAGCGAACATCCTGAA
GTGGAGAAGGGCGAGCTTTAA