METABLE2 Genes

PROKKA_00030 SelectedGram-

GenomeSelectedGram- ctg_1:29336-29653
ProductCDS hypothetical protein
Inferenceab initio prediction:Prodigal:2.6
Sequence
>PROKKA_00030 hypothetical protein
ATGGACAACCCATTTCAAATCATTACCGATGCATTCGCGCCGGACTATCAGATCAATCTG
AGCATTCAGGGCCTGGACGGCAGCATCATGCTGACCCTGTCCAACGCCGGCCGCATTGTG
GCCAAGCGCATGATCAGCGCCGAACAGCGCAACGATCCCGAGCGTTTGAAGAGGCTGGTG
CAAAGCATCCGGTTCGGCATCGCCATCGAACAGGGCCACAGCGCCATGTCGATCCTCGAA
GCCATGACCAGCGGCGCCGGGCTGACCCCGCCACCGCCACGGGTCAAAGGCCAGCCGGGT
CAGGCGGCGGGCCTTTAA