METABLE2 Genes

PROKKA_00035 SelectedGram-

GenomeSelectedGram- ctg_1:35586-36518
ProductCDS fec operon regulator FecR
Inferenceab initio prediction:Prodigal:2.6,protein motif:CLUSTERS:PRK09774
Sequence
>PROKKA_00035 fec operon regulator FecR
GTGAATCGCACGCCGGATTTCTCCGCGCAAGTCGCCGAACAGGCGGTGCACTGGTTGCTG
GAAATGCAGCAGGGCACCCTGACCCCGCGCCAGCAGCAGGCTTGGCAACACTGGCTGGAT
GCGCACAGCGAACATCGCCGAGCGTGGGAACACATGCAACGGGTCAACCAGCGCTTGCGC
GGCGTGTCGTCGCCGTTGGCCCACGCCGCGTTGAACGGACCGAAGTCCGGCAGCCGCCGT
CAGGCGCTGAAAATGTTGCTGATTCTCGGTGCCGGCTCAGCGGCGACCTGGGGCATGCGC
GAGCACACGCCGTTGCCGTCGCTGCTCGCCGATTACCGCACACCGATCGGCCAGCGGCGC
AAGATCGGCCTGGGCGGTGCCGATTCGTTACAGCTCAATACCGCCAGCTCGGTTGATGTT
GATGGTGCGCAGCGGTTGATTCGTCTGCTTGAGGGCGAAATGCTGTTGAGCGCCGCACAC
TCGTTTGAAGTCCGCACGGCACACGGCGTGCTGAAAACCCAAGGTGCGCGCCTCAATGTG
CGGCAGTTTGTTGATCGCACGCAGATCGCCCTGTTCGAAGGACGAGTCGAACTCGTCGCC
AACCAGCGCGCGCCCCTGCTGCTGCCGATCGCGCAGCAGTTGAGTTTTACTGCCAGCTCG
GTCAGCGCCCCCAAACCGCTGGACGCCAACAGCGGTGCATGGACCGACGGCATGCTGGTC
GCCGCCCATATGCGCCTCGGCGATTTCCTCGAAGAGCTTGGCCGCTACCGGCGCGGGCAG
CTGCGGTGCGACAGTCAGGTTGCCGATCTGCTGATTTCCGGGACGTATCCACTGGATGAC
AGCGAGCGGATTCTCGACCTGTTGCAGATCAGTCTGCCGGTCAGAGTGAAGCGCTTTACC
CGTTATTGGGTGAGCGTCGAAGCGCGGGTTTAG