METABLE2 Genes

PROKKA_00037 SelectedGram-

GenomeSelectedGram- ctg_1:37191-37496
ProductCDS hypothetical protein
Inferenceab initio prediction:Prodigal:2.6
Sequence
>PROKKA_00037 hypothetical protein
ATGAAAGGCAAACTCGCCACCCTTCCCATGTCCTATCGTCTGGCCGTCACTTCGCGGGTA
TTGGCGGCGATTTTCGGCGGCTATCTGGTCGCGGCGCTGGCCAGCGTCACCCTGACGTTG
TGGCTGCCGCTGAACCGCGCCGAAGCCGTGGTCACCGGCATGACCGTGTCCTTTCTGGTC
TATCTGGTTGCCGTGCTCTGGTGTTTTGCCTGCCGCAGCGCGTGGTCGGCGTGGGTCGGC
CTGTTGGTGCCGAGCGTGATTCTCGCCACCGTTTCCGGTGCCGCGCGCGGTCTGGGGCTG
GCATGA