METABLE2 Genes

PROKKA_00038 SelectedGram-

GenomeSelectedGram- ctg_1:37493-39076
ProductCDS hypothetical protein
Inferenceab initio prediction:Prodigal:2.6
Sequence
>PROKKA_00038 hypothetical protein
ATGAAGGAAGGGTTCCGGCAGGCGATGGCCTGGCTGCACACCTGGGCCGGGCTGGTGTTC
GGCTGGCTGCTGTTCGCGATTTTCCTCACGGGAACGCTTGCTTACTTCAAAGACGAAATC
AGCCACTGGATGCAGCCGGAAATTGCTGCGCATTCGCTCGATAGCGAAGCGAGCCTGACG
CAGGCGCAAAACTATCTGCAACAACACGCCGCCGGTGCCTCGCGCTGGCTGATCGATCTG
CCCGATGCCCGCGATCCCGGTCTGACCGTGCGCTGGCAACAGGCGCCGGGCAAACCCGGC
GAGCGCGGCCGCTTCGAATCCCGAACCCTCGACGCCCGGACCGGGGTCGAAGTACAGGGC
CGCGAAAGCATGGGCGGCGAGTTCTTTTACCGCTTTCACTTCCAGTTGCAGATGCCTTAC
CCGTGGGGGCGCTGGCTGGCGACCCTCGCCGCGATGGTGATGTTCGTTGCGTTGATCAGC
GGCATCATCACCCACAAGAAAATCTTCAAGGACCTCTTCACTTTCCGCCCGCGCAAGGGC
CAGCGTTCCTGGCTCGACGGGCATAACGCCGTGGGTGTGCTGGTGCTGCCGTTTCATTTG
ATGATCACTTACAGCAGCCTGGTGATTTTCATGTCGATGGTCATGCCGGCGAGCATCGTC
GCCTCTTACGGCAGCGACGTGCGCAAGTTCTACGACGAAGTCTTTCCCGCCTCGAAGACG
CCCGAGCGCGCTGATATCGCCGCACCGCTGACCGCCATGGCGCCGTTGCTGGCTAAAGCC
AGCGAGCAGTGGGCGGGCGGCCACACCGCGCGTCTGTCGGTGAGCAATCCGGGCGATGCC
AGCGCTACGGTGGTGCTGTCCCGCGCGGGCGATCGGGTGGTGCATGATTTCGGCCGGGCG
GTGACGTTCAATGGCGTCACCGGGCAGCTTCTGAGCAGTACCCCCGATCAACCCATGGCG
ATGGCGGTGGGTGGCGCGTTCTACGGTTTGCACATGGGCCATTTCGCCGGGCCGCTGTTG
CGCTGGCTGTATTTCATCTGCGGGCTGGCCGGCACGGCAATGATCGGCACCGGGCTGGTG
ATCTGGCTCGGCAAGCGTCAGCTCAAGCACCTAAAAAGCGCGGCGATGCCGTTCGAATTG
CGTTTGGTCGAGGTGCTGAATATCGCCAGCATGGCCGGCCTGGTATCGGCGGTGGCGGTG
TTCTTTCTGGCCAATCGACTGCTGCCGGTGAGTCTGGCAGGGCGGGCCGATTGGGAAGTG
AACGCGTTCTTCATAGTCTGGGGCCTGAGCGTGGTGCACGCGGTGTTGCGTCCGGGGCGC
AAGGCCTGGATCGAACAGCTGACGCTCGGCGCCGCGCTGTTTATCGCGGTGCCGCTGATC
AATGCGCTGACCACACCGTGGAATCTTGGCGCGACCCTGATGCAGCGCGACTGGGCACTG
GCCGGATTTGATCTGACTTGTCTGGCGACGGGGCTTTTTCTCGGCTGGGCTGCGCGCAAG
ATGCAGCGTACGGGCGAGCGCGTCAGCGTTCGCAAAGCAAGTTCTTCGGCTCGCTCGATC
ACAGTCGAACAGGGGGCCAACTGA